ID: 1166107668

View in Genome Browser
Species Human (GRCh38)
Location 19:40605385-40605407
Sequence CGCCTAGGGGAGGCACGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166107668_1166107678 16 Left 1166107668 19:40605385-40605407 CCCGGCCGTGCCTCCCCTAGGCG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107668_1166107682 28 Left 1166107668 19:40605385-40605407 CCCGGCCGTGCCTCCCCTAGGCG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1166107682 19:40605436-40605458 GCACCCGCAGGAGGCGTCGGTGG 0: 1
1: 0
2: 1
3: 14
4: 138
1166107668_1166107677 4 Left 1166107668 19:40605385-40605407 CCCGGCCGTGCCTCCCCTAGGCG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107668_1166107681 25 Left 1166107668 19:40605385-40605407 CCCGGCCGTGCCTCCCCTAGGCG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1166107681 19:40605433-40605455 GGAGCACCCGCAGGAGGCGTCGG 0: 1
1: 0
2: 2
3: 9
4: 151
1166107668_1166107680 19 Left 1166107668 19:40605385-40605407 CCCGGCCGTGCCTCCCCTAGGCG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1166107680 19:40605427-40605449 CCACGTGGAGCACCCGCAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166107668 Original CRISPR CGCCTAGGGGAGGCACGGCC GGG (reversed) Exonic
900127155 1:1073703-1073725 CCCCACGGGGACGCACGGCCAGG - Intronic
900136796 1:1121194-1121216 CCCATCAGGGAGGCACGGCCTGG - Intergenic
900172128 1:1274198-1274220 CCCTTAGGGGAGGCGCGGCGCGG + Intergenic
900386496 1:2413209-2413231 TGCCCACGGGAGGCAGGGCCTGG + Intronic
901087783 1:6622167-6622189 CGGCTGGGGGAGGCACTGGCGGG + Exonic
901791237 1:11654667-11654689 CGGCTAGGGGAGGCACGGAGAGG + Exonic
901887232 1:12231031-12231053 CGCCTCGGGGAGGGACGCCCAGG + Intronic
904631419 1:31845721-31845743 TCCCTAGGGGAGACACGACCTGG - Intergenic
904724886 1:32539692-32539714 CGTCTGGGGGAGGCGCGCCCGGG - Intronic
905463392 1:38135593-38135615 GGGCTTTGGGAGGCACGGCCTGG + Intergenic
906531471 1:46526304-46526326 AGCTTAGGGGAGGCCCAGCCTGG - Intergenic
909329336 1:74393738-74393760 CCCTGAGGGGAGGCAAGGCCAGG + Intronic
909486225 1:76177578-76177600 GGCCTAGGGAAGGCACGGATGGG - Intronic
910808317 1:91210805-91210827 CCCCTAGGGGAGGGACTGGCAGG + Intergenic
914878611 1:151530576-151530598 CGCCTAGAGGAGGCTCAGCGGGG + Exonic
916547061 1:165815878-165815900 AGCCTAGGGGAAGCATGGCCAGG - Intronic
919820524 1:201469220-201469242 CGCGGAGGGGAGGGCCGGCCAGG - Intronic
922208312 1:223467988-223468010 TGCCTAGGAGGGGCATGGCCAGG - Intergenic
922505540 1:226123437-226123459 CTCCAAGGGGAGGCCCTGCCAGG + Intergenic
924611586 1:245577976-245577998 CGTGTAGGGGATGCACTGCCAGG - Intronic
924929985 1:248721930-248721952 CTCTTAGGGGAGGCAGGGCCAGG + Intronic
1063021819 10:2136602-2136624 CACATAGGGGAGGCTGGGCCTGG - Intergenic
1063995183 10:11611836-11611858 CGCCTCGGGGACGCGCGCCCAGG + Intergenic
1064562795 10:16609269-16609291 CTCCTAGGTGAGGCAGTGCCAGG - Intronic
1064773149 10:18746669-18746691 CGCCTAGGGGAGGGAAGGGGAGG - Intergenic
1065810434 10:29438232-29438254 CCCCTAGGGGAGGGACCGGCGGG + Intergenic
1065844683 10:29735437-29735459 CGCCTCGGGGAGGAGCGGGCCGG - Intronic
1067531933 10:47080513-47080535 CTCCTAGGGGAGGCTGGGCATGG - Intergenic
1069651720 10:70053777-70053799 TGCCCAGGCGAGCCACGGCCGGG - Intronic
1070610185 10:77927128-77927150 CGCCTCCCGGAGGGACGGCCTGG - Intergenic
1070957170 10:80471797-80471819 CACCTAGGTGAGGCAGGGCCTGG - Intronic
1076728299 10:132424061-132424083 CCCCCAGGGGAGGCTCGGCTTGG + Intergenic
1076827027 10:132974239-132974261 CGCCTCTGGAAGGCACAGCCCGG - Intergenic
1077052082 11:571513-571535 TGCCTGGGGGAGGCAGGGGCAGG - Intergenic
1077530747 11:3093711-3093733 CCCTCAGGGCAGGCACGGCCGGG - Intronic
1082734962 11:56845494-56845516 CTCATCGGGGAGGCTCGGCCCGG - Intergenic
1083921658 11:65784302-65784324 AGCCGAGGGGAGGCCTGGCCTGG + Intergenic
1084372033 11:68751001-68751023 CGACCAGGGGAGGGGCGGCCGGG + Intronic
1084372053 11:68751043-68751065 CGACCAGGGGAGGGGCGGCCAGG + Intronic
1084410856 11:69005247-69005269 CGCCTGGAGGAGGCAGGGGCAGG - Exonic
1085485637 11:76860853-76860875 CCCCTCGGGGAGGCAGGGCCGGG + Exonic
1101442891 12:104716689-104716711 TGCCTGGGGGAGGCAGGGGCAGG + Intronic
1103730922 12:123027252-123027274 CACCTATGGGTGGCAAGGCCAGG - Intronic
1104860096 12:131919111-131919133 CGCCTTGGGGAGGCAGGGCAGGG - Intronic
1104860474 12:131920909-131920931 GGCCAAGGGGAGACACTGCCTGG - Intronic
1104981732 12:132576002-132576024 CGGCTGTGGGAGGCAGGGCCAGG - Intronic
1106052345 13:26203552-26203574 TGCCTGGGGGAAGCATGGCCTGG - Intronic
1106778585 13:33032688-33032710 CGCCAATGGGAGGAACAGCCAGG + Intronic
1108396581 13:49996784-49996806 CGCCAAGGCGAGGCGCGGCCGGG + Intronic
1113952859 13:114081326-114081348 AGCCCTGGGGAGGCCCGGCCTGG - Intronic
1114075104 14:19157657-19157679 CGCCTAGGAGAAGCTGGGCCTGG + Intergenic
1114087165 14:19242325-19242347 CGCCTAGGAGAAGCTGGGCCTGG - Intergenic
1119740676 14:77012030-77012052 GGCCTAGGGGAGGAACAGCCCGG - Intergenic
1122588075 14:102825142-102825164 CTCCTGGCGAAGGCACGGCCCGG - Intronic
1122833860 14:104421490-104421512 GGCCTGGGGGAGGCAGGGCTTGG + Intergenic
1122856033 14:104560710-104560732 CGGCTGGGGAAGGCACTGCCAGG - Intronic
1122976427 14:105172722-105172744 CTCCAAGAGGAGGCACAGCCTGG + Intergenic
1123008129 14:105334102-105334124 CGCCAAGGGGAAGCCAGGCCAGG - Intronic
1202899280 14_GL000194v1_random:26296-26318 CGCCTAGGAGAAGCTGGGCCTGG - Intergenic
1202899590 14_GL000194v1_random:27603-27625 CGCCGCGGAGAAGCACGGCCTGG - Intergenic
1126777593 15:52112772-52112794 ACCCTGGGGGAGGCGCGGCCGGG - Exonic
1130169353 15:81495844-81495866 AGCCTATGGGAGGCACTGACAGG - Intergenic
1131030147 15:89179675-89179697 AGCCTAGGGAAGGCAGGGGCAGG - Intronic
1132588753 16:717277-717299 CGCTTTGGGGAGGCCCGGCTGGG + Exonic
1133116413 16:3580257-3580279 AGGCCAGGGGAGGCATGGCCTGG - Intergenic
1136006799 16:27336379-27336401 CGCGTAAGGGAGGAAGGGCCGGG + Intronic
1136344001 16:29663623-29663645 GGCAGAGGGGAGGCCCGGCCAGG + Intronic
1139484732 16:67249092-67249114 AGCCTGGGGGAGGCTCGCCCGGG - Exonic
1142799656 17:2337389-2337411 CGCCTAGGGGCGGCAGACCCGGG - Exonic
1142876241 17:2853510-2853532 GGGCGAGGGGAGGCAGGGCCGGG + Intronic
1143551458 17:7632874-7632896 GGCCTAAGGGAGGCAGGGCAAGG - Exonic
1144847166 17:18225899-18225921 CGCCGAGGGGGTGCGCGGCCCGG - Intronic
1146086785 17:29837805-29837827 CGCAAAGAGGAGGCATGGCCAGG + Intronic
1147165758 17:38592357-38592379 CACCTTGGGGAGGCAGGGCAGGG - Intronic
1148878629 17:50707872-50707894 GGCCTTCGGGAGGCGCGGCCCGG - Exonic
1151194243 17:72420563-72420585 CTCCTGGGGGAGGCTCAGCCTGG - Intergenic
1151651960 17:75475692-75475714 TGCCTGGGGGATGCAGGGCCTGG + Intronic
1152013645 17:77735739-77735761 CGCCCAGGGCAGGCTGGGCCTGG - Intergenic
1153226999 18:2906970-2906992 CGCCTGCGGGGGGCCCGGCCTGG - Exonic
1154070819 18:11149724-11149746 CGCCTGGGAGAGACCCGGCCTGG + Intergenic
1160594222 18:79963213-79963235 TGCCTAGGGGTGGCGCGGCTGGG + Intergenic
1160952743 19:1675481-1675503 CTCCTCGGGGCGGCACAGCCCGG + Intergenic
1161013193 19:1969953-1969975 CGCCTAGGTGAGGCCCTGCTCGG + Exonic
1161048779 19:2151204-2151226 CGCCAAGGGGCTGCTCGGCCTGG - Intronic
1165932664 19:39370002-39370024 GGCCCTGGGGAGGCAGGGCCAGG + Exonic
1166107668 19:40605385-40605407 CGCCTAGGGGAGGCACGGCCGGG - Exonic
1167696596 19:51018990-51019012 CGCCGGTGGGAGGCACGGGCGGG - Intronic
1168611447 19:57804020-57804042 CCCCTAGGGGAGGGACCGGCAGG + Intronic
1168617434 19:57850012-57850034 CTACTTGGGGAAGCACGGCCCGG - Exonic
1168625727 19:57916416-57916438 CTACTTGGGGAAGCACGGCCCGG + Exonic
1202647867 1_KI270706v1_random:158026-158048 CGCCGCGGAGAAGCACGGCCTGG + Intergenic
1202648170 1_KI270706v1_random:159371-159393 CGCCTAGGAGAAGCTGGGCCTGG + Intergenic
925184838 2:1840000-1840022 CGCCTGAAGGAGGCAGGGCCTGG + Intronic
932583619 2:73008564-73008586 GGCCTGGGAGAGGCAGGGCCCGG - Intronic
933774532 2:85764218-85764240 AGCATAGGGGAGGCAGGGACAGG + Intronic
937887157 2:126907806-126907828 CTCCCAGCGGAGGCAGGGCCAGG + Intergenic
940112614 2:150171160-150171182 CTCGTCGGGGAGGCTCGGCCAGG + Intergenic
948491180 2:238314265-238314287 CGGTGAGGGGAGGCAGGGCCTGG + Intergenic
949046047 2:241873140-241873162 GGCCTACGGCAGGCACGGCCAGG - Exonic
1171349788 20:24493800-24493822 CTCAGAGGGGAGGCATGGCCGGG + Intronic
1173463895 20:43266095-43266117 AACCTAGGGGAGGCACAGCCTGG + Intergenic
1174019724 20:47520411-47520433 CCCCTAGGGGAGGAACCGGCAGG + Intronic
1174192780 20:48751970-48751992 AGTCTAGGGGAGGCACAGACTGG + Intronic
1175619964 20:60435188-60435210 AGCCTAGAGGAGGCAGGGCAAGG - Intergenic
1176603680 21:8813324-8813346 CGCCTAGGAGAAGCTGGGCCTGG - Intergenic
1176603984 21:8814703-8814725 CGCCGCGGAGAAGCACGGCCTGG - Intergenic
1176618663 21:9041066-9041088 CGCCTAGGAGAAGCTGGGCCTGG - Intergenic
1176618966 21:9042377-9042399 CGCCGCGGAGAAGCACGGCCTGG - Intergenic
1180043919 21:45294112-45294134 CACATAGGGGAGGCACAGCCTGG + Intergenic
1180179218 21:46110605-46110627 GGACTAGGGGAGGCGCTGCCAGG - Intronic
1180290752 22:10850566-10850588 CGCCTAGGAGAAGCTGGGCCTGG + Intergenic
1180345963 22:11704875-11704897 CGCCTAGGAGAAGCTGGGCCTGG - Intergenic
1180346268 22:11706280-11706302 CGCCGCGGAGAAGCACGGCCTGG - Intergenic
1180354039 22:11824437-11824459 CGCCGCGGAGAAGCACGGCCTGG - Intergenic
1180384206 22:12167888-12167910 CGCCGCGGAGAAGCACGGCCTGG + Intergenic
1180493553 22:15879993-15880015 CGCCTAGGAGAAGCTGGGCCTGG + Intergenic
1181028905 22:20140702-20140724 CGCCCCGGTGAGGCCCGGCCTGG + Exonic
1182246722 22:28964029-28964051 CACCTAGGGGAGTGACTGCCAGG + Intronic
1184103670 22:42355104-42355126 GGCCTAGGGCAGGCCAGGCCAGG - Intergenic
1184164746 22:42720700-42720722 CGCCTCGGGAAGGCAGGGGCAGG - Intronic
950428751 3:12938892-12938914 CCCCTGGGGGAGGAACTGCCAGG - Intronic
954360605 3:50120792-50120814 TCCCTAGGGGAGCCATGGCCAGG + Intergenic
966886562 3:184380476-184380498 CGCCCGGGGGAGGCGCGGGCGGG + Intronic
968235686 3:197029143-197029165 CGCCCCGGGGAGTCAGGGCCCGG - Intronic
968790563 4:2658377-2658399 TGCCTGGAGGAGGCACCGCCAGG - Intronic
973374443 4:49277521-49277543 CGCCTAGGAGAAGCTGGGCCTGG + Intergenic
973382968 4:49332720-49332742 CGCCTAGGAGAAGCTGGGCCTGG - Intergenic
973386594 4:49517762-49517784 CGCCTAGGAGAAGCTGGGCCTGG - Intergenic
977292442 4:95178329-95178351 CGCCTAGGGTATGCTCGCCCAGG - Intronic
980824073 4:138053002-138053024 CTCCTAGGGGAGGCTCGGGCTGG + Intergenic
985489760 5:172321-172343 CCACTAGGGGAGGGACAGCCTGG + Intronic
1002352125 5:178590435-178590457 CACCCAGGGGAGGAGCGGCCGGG + Exonic
1002607396 5:180391294-180391316 CGCCCACGGGAGGCAGAGCCAGG + Intergenic
1006440528 6:34051002-34051024 CCTCTAATGGAGGCACGGCCTGG + Intronic
1007737588 6:43991153-43991175 GGCCAAGGGGAAGGACGGCCAGG - Intergenic
1011099597 6:83708017-83708039 CGGCTGGAGGAGGCAAGGCCTGG - Intronic
1011570119 6:88725797-88725819 CCCCTAGGGGAGGGACTGGCTGG - Intronic
1017889385 6:158626226-158626248 CTCCCAGGGCAGGCTCGGCCTGG + Intronic
1018598686 6:165514620-165514642 CACCTAGCGGAGGGCCGGCCAGG - Intronic
1019795239 7:3043793-3043815 CGCCCAGGGGCTGCAGGGCCGGG + Exonic
1024232211 7:47371130-47371152 AGCCTAGGGGAGGAAGGGTCTGG + Intronic
1026564691 7:71480358-71480380 TGCCCAGGAGAGGCATGGCCAGG - Intronic
1026764949 7:73154695-73154717 GGCCGAGGGGAGGCACGGGGCGG - Intergenic
1027041421 7:74964465-74964487 GGCCGAGGGGAGGCACGGGGCGG - Intergenic
1027082219 7:75237911-75237933 GGCCGAGGGGAGGCACGGGGCGG + Intergenic
1029371738 7:100154922-100154944 ATCCCAGGGGAGGCACAGCCCGG + Exonic
1029390782 7:100272414-100272436 GGCCGAGGGGAGGCACGGGGCGG + Intergenic
1031966411 7:128031142-128031164 CGCCTGGGAGAGCCAAGGCCCGG + Intronic
1032128530 7:129211564-129211586 TGACTATGGGAGGCACTGCCAGG + Intronic
1035171131 7:157018028-157018050 CGCCCAGGGGAGGGAAGGTCAGG + Intergenic
1037906377 8:22718248-22718270 GGCCTAGGGGATGCACTGGCTGG - Intronic
1040444271 8:47477885-47477907 GCCCTAGGGGAGGCACCCCCAGG + Intronic
1049420700 8:142515276-142515298 CGCCGAGGGGAGGCAGAGCCAGG - Intronic
1055638117 9:78297367-78297389 CGCCTAGGGGACTCAAGGCAGGG - Intronic
1062083855 9:134638493-134638515 GGCCTGGGTGAGCCACGGCCTGG - Intergenic
1062530538 9:136997582-136997604 CGCCTGGGGGAGGTGTGGCCAGG - Intergenic
1203698109 Un_GL000214v1:115429-115451 CGCCTAGGAGAAGCTGGGCCTGG + Intergenic
1190310990 X:49116966-49116988 TTCCTAGGGGTGGCAGGGCCTGG - Intronic
1190690167 X:52907384-52907406 CCTCTGGGAGAGGCACGGCCTGG - Exonic
1190695816 X:52948408-52948430 CCTCTGGGAGAGGCACGGCCTGG + Exonic
1198742217 X:139853188-139853210 CCCCTAGGGGAGGGACTGGCGGG - Intronic
1201152365 Y:11101153-11101175 CGCCTAGGAGAAGCTGGGCCTGG - Intergenic
1201312753 Y:12611915-12611937 TGGCTAGGGGAGGCAGGACCTGG - Intergenic