ID: 1166107669

View in Genome Browser
Species Human (GRCh38)
Location 19:40605386-40605408
Sequence ACGCCTAGGGGAGGCACGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166107669_1166107677 3 Left 1166107669 19:40605386-40605408 CCGGCCGTGCCTCCCCTAGGCGT 0: 1
1: 0
2: 2
3: 4
4: 109
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107669_1166107681 24 Left 1166107669 19:40605386-40605408 CCGGCCGTGCCTCCCCTAGGCGT 0: 1
1: 0
2: 2
3: 4
4: 109
Right 1166107681 19:40605433-40605455 GGAGCACCCGCAGGAGGCGTCGG 0: 1
1: 0
2: 2
3: 9
4: 151
1166107669_1166107678 15 Left 1166107669 19:40605386-40605408 CCGGCCGTGCCTCCCCTAGGCGT 0: 1
1: 0
2: 2
3: 4
4: 109
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107669_1166107684 30 Left 1166107669 19:40605386-40605408 CCGGCCGTGCCTCCCCTAGGCGT 0: 1
1: 0
2: 2
3: 4
4: 109
Right 1166107684 19:40605439-40605461 CCCGCAGGAGGCGTCGGTGGTGG 0: 1
1: 0
2: 2
3: 23
4: 219
1166107669_1166107682 27 Left 1166107669 19:40605386-40605408 CCGGCCGTGCCTCCCCTAGGCGT 0: 1
1: 0
2: 2
3: 4
4: 109
Right 1166107682 19:40605436-40605458 GCACCCGCAGGAGGCGTCGGTGG 0: 1
1: 0
2: 1
3: 14
4: 138
1166107669_1166107680 18 Left 1166107669 19:40605386-40605408 CCGGCCGTGCCTCCCCTAGGCGT 0: 1
1: 0
2: 2
3: 4
4: 109
Right 1166107680 19:40605427-40605449 CCACGTGGAGCACCCGCAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166107669 Original CRISPR ACGCCTAGGGGAGGCACGGC CGG (reversed) Exonic
900145562 1:1157483-1157505 AGGCCGATGGGAGGCAGGGCTGG - Intergenic
900362770 1:2297909-2297931 ACGCTGAGGGGACGCACGGGAGG + Intronic
900538520 1:3190996-3191018 ACCCCCAGGGGAGGCACTGGGGG + Intronic
900585899 1:3432212-3432234 AGGCCTAGGAGGGCCACGGCGGG - Intronic
901022167 1:6261018-6261040 GCGCCTAGGGGAGGGAGGGGCGG - Intergenic
901670229 1:10851695-10851717 AAGCCAAGGGCAGGCAAGGCTGG + Intergenic
902191044 1:14763509-14763531 ACTCCAAGGGGAGGCAGGGGTGG - Intronic
903383458 1:22912165-22912187 AAGTCTAGGGAAGGCACTGCAGG - Intronic
903845624 1:26278393-26278415 AGATCTAGAGGAGGCACGGCTGG - Exonic
904724887 1:32539693-32539715 ACGTCTGGGGGAGGCGCGCCCGG - Intronic
906296934 1:44654684-44654706 ACGCATGGTGGAGGCACGCCTGG - Exonic
906671814 1:47661315-47661337 ATGCCAAAGGGAGGCATGGCAGG - Intergenic
907459649 1:54597805-54597827 AAGAGTAGGGGAAGCACGGCAGG - Intronic
909486226 1:76177579-76177601 TGGCCTAGGGAAGGCACGGATGG - Intronic
914505924 1:148288657-148288679 ACGACTAGGGGAAGCCCGGAGGG + Intergenic
914878610 1:151530575-151530597 ACGCCTAGAGGAGGCTCAGCGGG + Exonic
916127168 1:161581645-161581667 ACACCCAGGGGAGGGAAGGCAGG + Intronic
916137088 1:161663449-161663471 ACACCCAGGGGAGGGAAGGCAGG + Intronic
918110161 1:181448771-181448793 ACACCCAGGGGAGGCCCTGCAGG - Intronic
919741222 1:200982728-200982750 AGGCCTAGGGGATGCTGGGCTGG - Intronic
923769037 1:236921323-236921345 ACGCCTAGCGGAGGAATTGCTGG + Intergenic
1062896079 10:1104339-1104361 ACGCCCAGAGGAGCCCCGGCTGG - Intronic
1067237906 10:44467227-44467249 AGGCCCAGGGTAGGCAGGGCAGG - Intergenic
1072741759 10:97914120-97914142 AGGCCTAGGGGAGGCAGGGCAGG + Intronic
1076836211 10:133022263-133022285 GAGCCTAAGGGAGGCAGGGCCGG + Intergenic
1077077608 11:708568-708590 AAGCCTAGGGGAGGGACTGGAGG - Intronic
1082776469 11:57248881-57248903 AAGCCTCGGGCAGGCAGGGCAGG - Intergenic
1083038977 11:59668572-59668594 ACCCCTAGAGGAGCCACGGAGGG - Intronic
1084214796 11:67641465-67641487 GCGCCTCGGGCAGGCAGGGCGGG - Intergenic
1085442945 11:76579742-76579764 ACGCCACTGGGAGGCATGGCTGG + Intergenic
1085485635 11:76860852-76860874 GCCCCTCGGGGAGGCAGGGCCGG + Exonic
1098012016 12:66063100-66063122 AGGACTAGGGGAAGCAGGGCTGG + Intergenic
1103953998 12:124566783-124566805 ACGCCTAGGAGGGACAAGGCTGG + Intronic
1104860097 12:131919112-131919134 ACGCCTTGGGGAGGCAGGGCAGG - Intronic
1104956282 12:132467565-132467587 ACGCCTAGGAGTGGAACTGCTGG - Intergenic
1108396580 13:49996783-49996805 CCGCCAAGGCGAGGCGCGGCCGG + Intronic
1114070085 14:19098957-19098979 ACGCCTGGGGTCGGCCCGGCGGG + Intergenic
1117729974 14:58712589-58712611 AGGCCTGTGGGAGGCACGGAAGG + Intergenic
1118051502 14:62034332-62034354 ATGCCTAGGAGTGGCACTGCTGG - Intronic
1119908056 14:78323455-78323477 AAACCTGGGGCAGGCACGGCAGG - Intronic
1120229736 14:81829556-81829578 AGGGCTTGGGGAGGCATGGCAGG + Intergenic
1122075262 14:99231432-99231454 ACGGCAGGGGGAGGCAGGGCGGG + Exonic
1122483607 14:102063673-102063695 ACGCCTGGGGGAGCGGCGGCCGG + Intergenic
1127896450 15:63303922-63303944 ACGCCTAGGAGTGGGACTGCTGG + Intronic
1127996455 15:64155768-64155790 AGGCCTAGGGGAGGTGCTGCAGG + Exonic
1129449883 15:75645322-75645344 ACGCCTCGGGGAGGTTGGGCTGG + Intronic
1132588752 16:717276-717298 CCGCTTTGGGGAGGCCCGGCTGG + Exonic
1136006798 16:27336378-27336400 ACGCGTAAGGGAGGAAGGGCCGG + Intronic
1136284368 16:29232527-29232549 ACTCCTGGGGGGAGCACGGCAGG - Intergenic
1136381233 16:29896907-29896929 AGGCCCTGGGGAGGCAGGGCTGG + Exonic
1138073688 16:54019373-54019395 ATGCCTATGGGAGGCACTGTTGG - Intronic
1139484733 16:67249093-67249115 AAGCCTGGGGGAGGCTCGCCCGG - Exonic
1140073383 16:71673218-71673240 AAGCCTAGAAGAGGCACTGCTGG + Intronic
1140911172 16:79454391-79454413 ACCCCTGAGGGAGGCACAGCTGG - Intergenic
1142089402 16:88202039-88202061 ACTCCTGGGGGGAGCACGGCAGG - Intergenic
1144638562 17:16925622-16925644 ACAGCTAGGGGAGGCCGGGCAGG + Intergenic
1144699633 17:17328527-17328549 ATGCCTGGGGGAGGCAAGGAAGG + Intronic
1145057946 17:19715333-19715355 ACGCCTGGGGAAGCCAGGGCTGG + Intronic
1147056113 17:37836426-37836448 AGGCGTAGTGGAGGCACGGTGGG - Intergenic
1147165759 17:38592358-38592380 TCACCTTGGGGAGGCAGGGCAGG - Intronic
1151646843 17:75438319-75438341 ATGCCTAGGAGTGGCACTGCTGG - Intergenic
1151990437 17:77570833-77570855 CCGCCCAGGGGAGGCCTGGCTGG + Intergenic
1152098389 17:78286457-78286479 AAGCCCAGGGGAGGCAGGGGTGG - Intergenic
1152845782 17:82598979-82599001 AGACCTAGGGGAGGCACGGGAGG - Intronic
1160594221 18:79963212-79963234 ATGCCTAGGGGTGGCGCGGCTGG + Intergenic
1161046352 19:2136836-2136858 ACGCAGAGAGGAGGCCCGGCGGG - Intronic
1161587564 19:5113833-5113855 ACGCCGAGGGCAGGGAAGGCTGG - Intronic
1161999415 19:7733742-7733764 ACACCTTGGGGAGCCAAGGCAGG + Intronic
1162032739 19:7924564-7924586 AGGGCTGCGGGAGGCACGGCAGG + Exonic
1162458356 19:10799360-10799382 ACGCCGAGGGGAGGGAGGGAGGG - Intronic
1162778700 19:12995780-12995802 GCGGCGAGGGGAGGCCCGGCAGG - Exonic
1163278819 19:16302578-16302600 ACGACTCGGGGAGGCGCGTCGGG + Intergenic
1164194160 19:22939925-22939947 ACTTCTAGGAGAGGCCCGGCGGG + Intergenic
1164538813 19:29106820-29106842 AGGCCTAGGGGAGGAAAAGCTGG + Intergenic
1166107669 19:40605386-40605408 ACGCCTAGGGGAGGCACGGCCGG - Exonic
1167611918 19:50511826-50511848 ACGCCTGGGGGAGGCAGTGGTGG + Intronic
925392379 2:3505330-3505352 ACCCCTATGGGAAGCAGGGCTGG + Intronic
929944855 2:46362571-46362593 AGGCCTAGGGGAGGCTGAGCAGG - Intronic
935082740 2:99814442-99814464 ACGCATAGGGAAGGAAGGGCAGG + Intronic
936591942 2:113812745-113812767 ATCCCTAGGGGAGGCCGGGCAGG + Intergenic
938239349 2:129731220-129731242 AGGCCTGGGGGAGCCCCGGCAGG + Intergenic
938382293 2:130843461-130843483 CAGCCCAGGGGAGGCACGGAAGG - Intronic
938780154 2:134577403-134577425 AGGGTTAGGGGAGGCACAGCTGG + Intronic
947593223 2:231396375-231396397 ACCCCTAGGGCTGGCAGGGCCGG + Intronic
948593599 2:239066052-239066074 ACGCCTGGTGGAGGCCCTGCTGG + Intronic
948708046 2:239807272-239807294 ACGCCTCCCGGAGGCACTGCTGG + Intergenic
948898912 2:240946202-240946224 AGGCCTTGGAGAGGCAGGGCCGG + Intronic
1168754665 20:308087-308109 AGGCCCAGAGGAGGCAGGGCTGG - Intergenic
1169361252 20:4951071-4951093 ACGCCTAGGGGAGCCAAGAACGG + Intronic
1170625020 20:18023712-18023734 ATGCCTGGGGGTGGCATGGCAGG - Intronic
1178610264 21:34073631-34073653 ACGCGAAGGGGCGGGACGGCGGG - Exonic
1181273456 22:21674099-21674121 AGGCCCAGGGGAGACACAGCGGG - Intronic
951035416 3:17927103-17927125 ATCTCTAGGGGAGGCATGGCTGG + Intronic
952414278 3:33076256-33076278 AGGCCTGGGGGAGGGAGGGCAGG + Intronic
954320359 3:49828480-49828502 ATGCCTAGGGAAGGAACTGCTGG + Intergenic
954581221 3:51703920-51703942 GCCCTTAGGGGAGTCACGGCTGG + Exonic
958911475 3:99999033-99999055 GTGCCTATGGGAGGCACGGAAGG - Intronic
961591197 3:127983020-127983042 CCCCATAGAGGAGGCACGGCTGG - Intronic
962450480 3:135512003-135512025 ACCCCTAGGAGAGGAATGGCTGG - Intergenic
963520447 3:146355794-146355816 GCTCCTAGGGGAGGCAGGCCTGG - Intergenic
964970638 3:162555211-162555233 AGGACTATGGGAGGCAAGGCAGG - Intergenic
967422158 3:189285321-189285343 AGGCCTAGGCGAGGAAAGGCGGG + Intronic
968701891 4:2061328-2061350 GGGGCTGGGGGAGGCACGGCCGG + Intronic
969398968 4:6940949-6940971 TTGCCTAAGGGAGGCACTGCAGG + Intronic
1009969271 6:70609356-70609378 ATGCCTGGGGGAGGGGCGGCAGG + Intergenic
1019298923 7:293612-293634 ACGCCTGGGAGAGGCAAGGGCGG + Intergenic
1028823653 7:95243779-95243801 ATGACTGGGGGAGGCAGGGCAGG - Intronic
1031468778 7:122144878-122144900 ACGCCTTGGGGAATCACAGCTGG - Intergenic
1035532092 8:361102-361124 TCGCCATGGGGAAGCACGGCAGG - Intergenic
1037323518 8:17665959-17665981 AACCTTAGGGGAGGCCCGGCTGG - Intronic
1038726048 8:30083219-30083241 AGGGCCTGGGGAGGCACGGCTGG + Intergenic
1042211313 8:66383342-66383364 AGGCCTTGGGGAGGCAAGGGAGG + Intergenic
1055638118 9:78297368-78297390 GCGCCTAGGGGACTCAAGGCAGG - Intronic
1056690840 9:88807547-88807569 ACTCCCTGGGGAGGCACGGTTGG + Intergenic
1059329508 9:113525952-113525974 AAGCCTAGGGGAGGCTGGGCAGG - Intronic
1188431023 X:30105587-30105609 GCTCCTAGGGGAGGCAGGCCTGG - Intergenic