ID: 1166107675

View in Genome Browser
Species Human (GRCh38)
Location 19:40605399-40605421
Sequence CACCATAGATGCCACGCCTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 33}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166107675_1166107680 5 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107680 19:40605427-40605449 CCACGTGGAGCACCCGCAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 105
1166107675_1166107682 14 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107682 19:40605436-40605458 GCACCCGCAGGAGGCGTCGGTGG 0: 1
1: 0
2: 1
3: 14
4: 138
1166107675_1166107678 2 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107675_1166107684 17 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107684 19:40605439-40605461 CCCGCAGGAGGCGTCGGTGGTGG 0: 1
1: 0
2: 2
3: 23
4: 219
1166107675_1166107687 29 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107687 19:40605451-40605473 GTCGGTGGTGGTGCACCAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 100
1166107675_1166107681 11 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107681 19:40605433-40605455 GGAGCACCCGCAGGAGGCGTCGG 0: 1
1: 0
2: 2
3: 9
4: 151
1166107675_1166107686 26 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107686 19:40605448-40605470 GGCGTCGGTGGTGGTGCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 110
1166107675_1166107677 -10 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166107675 Original CRISPR CACCATAGATGCCACGCCTA GGG (reversed) Exonic
905814879 1:40941891-40941913 CACCATAGGCACCATGCCTAGGG - Intergenic
910466581 1:87506784-87506806 CACCATAGATTCCCTGCTTATGG + Intergenic
916169429 1:161989520-161989542 CACCATAGTTGCCAGGGCTATGG + Intronic
917340280 1:173969429-173969451 TACAATAGATGCCATGTCTAAGG - Intronic
1067201847 10:44179660-44179682 CACAATTCATGCCACGACTATGG - Intergenic
1092547485 12:9464862-9464884 CACCCCAGATGCCACTGCTAGGG - Intergenic
1105005744 12:132719542-132719564 CAGCATAGAAGCCACCCATATGG - Intronic
1118357638 14:65027836-65027858 CATTAGAGATGCCAAGCCTAAGG + Intronic
1119212791 14:72845445-72845467 AAGCATAGATGCCAGGCCTGGGG - Intronic
1121755216 14:96396750-96396772 CACCACAGAAGCCACTTCTAAGG + Intronic
1123125179 14:105941152-105941174 CCCCACAGATGCAACGCCTGTGG - Intergenic
1125219881 15:37320488-37320510 CTCCATAGATTCCACCTCTATGG + Intergenic
1130956080 15:88628424-88628446 CACCAGGGAGGCCACGCCCAGGG - Intronic
1132590705 16:725177-725199 CACCAGAGACCCCAAGCCTAGGG - Intronic
1139463676 16:67142474-67142496 CACCATGGATGGCACGCTGATGG - Intronic
1143025734 17:3941141-3941163 CCCCAAAGATGCCAAGCCTGCGG + Exonic
1151995912 17:77609174-77609196 CACCAGAAATGCCATGCCTAGGG - Intergenic
1155340939 18:24813564-24813586 CACCATGACTGCCACCCCTAGGG + Intergenic
1160580554 18:79882542-79882564 CACCAAAGAAGACACGCCTATGG + Intronic
1164589514 19:29498701-29498723 CACCAGAGCTGCCACTCCTGCGG + Intergenic
1166107675 19:40605399-40605421 CACCATAGATGCCACGCCTAGGG - Exonic
925095127 2:1192343-1192365 CACCATAGACTCCACACCCAGGG + Intronic
940183736 2:150960815-150960837 CATCATGGATGCCAAGCCTTGGG + Intergenic
952258848 3:31719800-31719822 CAACCTAAATGCCACTCCTAGGG + Intronic
954141010 3:48605509-48605531 CACCAGAGAAGCCAGGCCTGTGG - Intronic
961629430 3:128285274-128285296 CACCATAGCTCCCACGCCAGAGG - Intronic
961820884 3:129575153-129575175 CACCCCAGATGCCACGCTCAAGG + Intronic
963726412 3:148926830-148926852 CACCATAGAAGCCTATCCTATGG - Intergenic
978035173 4:103984288-103984310 CACCATAGATACAAGGCCTGGGG + Intergenic
986821676 5:11474018-11474040 CAGCATAGATGCCATGCTTCAGG - Intronic
1015798444 6:137036253-137036275 CACCATAGATGCCAAGCCCATGG + Intronic
1018745519 6:166758675-166758697 GACAATAGAGGCCACGGCTAAGG + Intronic
1019209134 6:170390887-170390909 CACCATTGCTGCCTCGCCTTGGG + Intronic
1020951441 7:14683330-14683352 CATCATACATGCCAGGCCTTTGG + Intronic
1029471607 7:100758322-100758344 CAGTATGGATGCCACCCCTACGG + Exonic
1030516337 7:110543309-110543331 CATGATAGAAGCCACACCTATGG + Intergenic
1190775009 X:53545630-53545652 CACCATCTATTCCACACCTATGG - Intronic
1197127688 X:122966980-122967002 CTCCATTGATGCCTCTCCTAAGG - Intergenic