ID: 1166107677

View in Genome Browser
Species Human (GRCh38)
Location 19:40605412-40605434
Sequence ATCTATGGTGAGCGTCCACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166107668_1166107677 4 Left 1166107668 19:40605385-40605407 CCCGGCCGTGCCTCCCCTAGGCG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107669_1166107677 3 Left 1166107669 19:40605386-40605408 CCGGCCGTGCCTCCCCTAGGCGT 0: 1
1: 0
2: 2
3: 4
4: 109
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107674_1166107677 -9 Left 1166107674 19:40605398-40605420 CCCCTAGGCGTGGCATCTATGGT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107666_1166107677 11 Left 1166107666 19:40605378-40605400 CCGTTTGCCCGGCCGTGCCTCCC 0: 1
1: 0
2: 4
3: 15
4: 226
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107672_1166107677 -6 Left 1166107672 19:40605395-40605417 CCTCCCCTAGGCGTGGCATCTAT 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107664_1166107677 23 Left 1166107664 19:40605366-40605388 CCGTGTAGACATCCGTTTGCCCG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107663_1166107677 24 Left 1166107663 19:40605365-40605387 CCCGTGTAGACATCCGTTTGCCC 0: 1
1: 0
2: 1
3: 2
4: 50
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107671_1166107677 -1 Left 1166107671 19:40605390-40605412 CCGTGCCTCCCCTAGGCGTGGCA 0: 1
1: 0
2: 2
3: 21
4: 178
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1166107675_1166107677 -10 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166107677 Original CRISPR ATCTATGGTGAGCGTCCACG TGG Exonic
909329105 1:74391316-74391338 ATCTATGGTGACATTCCAAGTGG + Intronic
1113264742 13:108605452-108605474 ATGTTGGGTGAGGGTCCACGTGG + Intronic
1116279232 14:42880610-42880632 ATCTCTGGGGACCGTCCAAGAGG - Intergenic
1123472429 15:20565242-20565264 ATCTTTGGTAAGAGTCCACTGGG + Intergenic
1123645575 15:22435111-22435133 ATCTTTGGTAAGAGTCCACTGGG - Intergenic
1123732734 15:23160233-23160255 ATCTTTGGTAAGAGTCCACTGGG + Intergenic
1123750867 15:23357613-23357635 ATCTTTGGTAAGAGTCCACTGGG + Exonic
1124283238 15:28381529-28381551 ATCTTTGGTAAGAGTCCACTGGG + Exonic
1124299461 15:28530084-28530106 ATCTTTGGTAAGAGTCCACTGGG - Exonic
1124481825 15:30086098-30086120 ATCTCTGGTAAGAGTCCACTGGG + Exonic
1124488281 15:30138196-30138218 ATCTCTGGTAAGAGTCCACTGGG + Exonic
1124543371 15:30607170-30607192 ATCTCTGGTAAGAGTCCACTGGG + Exonic
1124755246 15:32400124-32400146 ATCTCTGGTAAGAGTCCACTGGG - Exonic
1127674220 15:61225518-61225540 ATCTAAGCTGAGCTTCCAGGGGG + Intronic
1132385536 15:101397630-101397652 AGCTGTGGTCAGCGTCCAGGAGG - Intronic
1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG + Exonic
937993750 2:127678507-127678529 GGCTATGGTGAGCGTCCAGGAGG + Intronic
962717134 3:138136382-138136404 ATCTATGCTAAGTGTCCACATGG + Intergenic
966043667 3:175523608-175523630 AGCAATGGTGAGCGTACACTTGG + Intronic
966306548 3:178542096-178542118 ATCAATGGTGAGCGCACACTTGG - Intronic
981476900 4:145196446-145196468 AACAATGGTGAGCGCCCAGGTGG + Intergenic
985791340 5:1929474-1929496 ATCTATGTTGAGTGTGCATGTGG + Intergenic
1000897247 5:166870177-166870199 ATCTTTGGTGATCCTCCACAGGG + Intergenic
1012108463 6:95196647-95196669 ATCCATGGTTAGTGTCCACAGGG + Intergenic
1027685891 7:81278647-81278669 ATCTTTGGTGAGTATTCACGTGG - Intergenic
1034199203 7:149271701-149271723 ATCTATAGTGAGAGGCCACAAGG - Intronic
1034420275 7:150986935-150986957 ACCTATGGTGAGCATTCAGGAGG + Intergenic
1049537728 8:143189787-143189809 ATCTGTGGGGAGAGCCCACGGGG - Intergenic