ID: 1166107678

View in Genome Browser
Species Human (GRCh38)
Location 19:40605424-40605446
Sequence CGTCCACGTGGAGCACCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166107668_1166107678 16 Left 1166107668 19:40605385-40605407 CCCGGCCGTGCCTCCCCTAGGCG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107672_1166107678 6 Left 1166107672 19:40605395-40605417 CCTCCCCTAGGCGTGGCATCTAT 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107671_1166107678 11 Left 1166107671 19:40605390-40605412 CCGTGCCTCCCCTAGGCGTGGCA 0: 1
1: 0
2: 2
3: 21
4: 178
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107666_1166107678 23 Left 1166107666 19:40605378-40605400 CCGTTTGCCCGGCCGTGCCTCCC 0: 1
1: 0
2: 4
3: 15
4: 226
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107676_1166107678 1 Left 1166107676 19:40605400-40605422 CCTAGGCGTGGCATCTATGGTGA 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107669_1166107678 15 Left 1166107669 19:40605386-40605408 CCGGCCGTGCCTCCCCTAGGCGT 0: 1
1: 0
2: 2
3: 4
4: 109
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107674_1166107678 3 Left 1166107674 19:40605398-40605420 CCCCTAGGCGTGGCATCTATGGT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107675_1166107678 2 Left 1166107675 19:40605399-40605421 CCCTAGGCGTGGCATCTATGGTG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166107678 Original CRISPR CGTCCACGTGGAGCACCCGC AGG Exonic
900186755 1:1336478-1336500 GGTCCACCCGGAGCAGCCGCCGG - Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
904428145 1:30444912-30444934 CGTGCAAGTGGAGCACATGCAGG - Intergenic
904769076 1:32870940-32870962 CGTCCACGTCGGGCGCCCGGGGG + Intronic
907490469 1:54806010-54806032 CGCCCACGTGGCGCCCCCACCGG - Intergenic
921168698 1:212526392-212526414 AGTTCACGTGAAGCACCTGCAGG - Intergenic
1066597064 10:37062512-37062534 CGCCCACCTGGAACTCCCGCTGG - Intergenic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1073326155 10:102644857-102644879 CCTGCACGTGGAGAAGCCGCCGG + Exonic
1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG + Exonic
1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG + Intergenic
1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG + Exonic
1084000139 11:66291730-66291752 CGTCCCCGAGAAGCCCCCGCTGG - Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1101604690 12:106239377-106239399 CGTCACCGTAGAGCACCAGCTGG + Exonic
1103048718 12:117761027-117761049 CGTCCACGCGGTGCCCCAGCTGG + Exonic
1109884356 13:68523987-68524009 CGTCCACCTGGAACTCACGCTGG - Intergenic
1115592041 14:34874317-34874339 CCTCCACCTGGAGAACGCGCGGG - Intronic
1119759212 14:77139708-77139730 CCACCACGTTGAGCAGCCGCAGG + Exonic
1127916414 15:63459111-63459133 CGCCCACCCGGAACACCCGCTGG - Intergenic
1132862653 16:2079226-2079248 CTTGCCCGTGGAGCTCCCGCAGG - Intronic
1138193246 16:55033688-55033710 CTTCCACGGGGAGCGCCTGCCGG + Intergenic
1140035020 16:71365126-71365148 CCTCCATCTGGAGCACCCTCTGG - Intronic
1145029629 17:19494992-19495014 CGTCCAAGAGGCCCACCCGCAGG - Intergenic
1145036096 17:19541618-19541640 CGTCCACTTGGAGTCCCAGCGGG - Intronic
1146260082 17:31415263-31415285 TGTCCACGTAGAGCGCCCCCTGG - Intronic
1152145282 17:78564594-78564616 CTTCCACGTGGAGCCCCTGAAGG - Intronic
1152347552 17:79762501-79762523 ACTCCACGTGGGGCATCCGCTGG + Intergenic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG + Exonic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
1169488431 20:6052493-6052515 CGGCCACCTGGAGCAGCTGCAGG - Exonic
1175859596 20:62143234-62143256 CTTCCAAGTGGAGTACGCGCAGG - Exonic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1178922413 21:36747550-36747572 CGCCCACGCGCTGCACCCGCGGG - Intronic
1180975411 22:19845309-19845331 GGTCCACCTGCAGCACCCACAGG - Intronic
1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG + Intergenic
1183032173 22:35114472-35114494 CGTGCACGTGGAGCTCCAGCTGG - Intergenic
951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG + Intronic
954660309 3:52223559-52223581 CGCCCACATCGAGCACACGCAGG + Exonic
960126568 3:114005153-114005175 GGTCCACATGGAGCAGCCCCTGG - Intronic
963168045 3:142225181-142225203 CGGCCACCTGCAGCACCCGCGGG - Intronic
965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG + Intronic
980930343 4:139177676-139177698 CGTGCACCTGCAGCGCCCGCCGG + Intergenic
985111932 4:186555308-186555330 CGTCCCCGCGGAGCACGGGCTGG + Exonic
985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG + Intergenic
985798657 5:1985878-1985900 AGTCCACCTGGAGCATCTGCTGG - Intergenic
986023345 5:3825396-3825418 CGTCCACGTGAAGTCCCCTCAGG + Intergenic
993202232 5:84830611-84830633 CGCCCACCTGGAACTCCCGCTGG + Intergenic
994206639 5:97043278-97043300 CATTCACTTGGAACACCCGCAGG - Intergenic
995700337 5:114928882-114928904 CGTCCACCTGGAACTCACGCTGG - Intergenic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1006151475 6:31992382-31992404 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1006157776 6:32025120-32025142 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1009615518 6:65999680-65999702 CGTCCACCTGGAACTCACGCTGG + Intergenic
1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG + Intronic
1020445510 7:8262573-8262595 TGGCCACGTGGAACACCTGCCGG - Intronic
1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1024256927 7:47546294-47546316 CGTCCACGTCCGGCACCCCCTGG + Intronic
1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029759618 7:102593742-102593764 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG + Intronic
1047203087 8:122782429-122782451 CGTCCCGGTGGAGTCCCCGCGGG - Intronic
1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG + Exonic
1192186736 X:68952206-68952228 CGTCCACCTGGAACTCCAGCTGG - Intergenic
1200066621 X:153507110-153507132 TGTCCAAGTGGAGCTCCCGGAGG - Exonic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic