ID: 1166108852

View in Genome Browser
Species Human (GRCh38)
Location 19:40610817-40610839
Sequence TCACTTGGCCTCTGCATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 469}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166108852_1166108857 10 Left 1166108852 19:40610817-40610839 CCTGGGATGCAGAGGCCAAGTGA 0: 1
1: 0
2: 6
3: 51
4: 469
Right 1166108857 19:40610850-40610872 AAAGGCTGAGTCATGAAAGATGG 0: 1
1: 0
2: 2
3: 31
4: 328
1166108852_1166108856 -8 Left 1166108852 19:40610817-40610839 CCTGGGATGCAGAGGCCAAGTGA 0: 1
1: 0
2: 6
3: 51
4: 469
Right 1166108856 19:40610832-40610854 CCAAGTGATGGGAAACAGAAAGG 0: 1
1: 0
2: 2
3: 29
4: 296
1166108852_1166108860 29 Left 1166108852 19:40610817-40610839 CCTGGGATGCAGAGGCCAAGTGA 0: 1
1: 0
2: 6
3: 51
4: 469
Right 1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 8
3: 86
4: 945
1166108852_1166108858 25 Left 1166108852 19:40610817-40610839 CCTGGGATGCAGAGGCCAAGTGA 0: 1
1: 0
2: 6
3: 51
4: 469
Right 1166108858 19:40610865-40610887 AAAGATGGAGAAGCAGAATGAGG 0: 1
1: 0
2: 11
3: 105
4: 1151
1166108852_1166108859 28 Left 1166108852 19:40610817-40610839 CCTGGGATGCAGAGGCCAAGTGA 0: 1
1: 0
2: 6
3: 51
4: 469
Right 1166108859 19:40610868-40610890 GATGGAGAAGCAGAATGAGGAGG 0: 1
1: 0
2: 10
3: 212
4: 2269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166108852 Original CRISPR TCACTTGGCCTCTGCATCCC AGG (reversed) Intronic
900345209 1:2207236-2207258 CCACATGGCCTGTGCATCCAGGG + Intronic
900346899 1:2214449-2214471 TCACTTGGCCTGTGGGTGCCTGG + Intergenic
900565733 1:3331065-3331087 TCCCTTGGCCCCTGGAGCCCGGG - Intronic
900648886 1:3721442-3721464 TCTCATGGCCTCAGCAGCCCTGG - Intronic
900933327 1:5750410-5750432 TATCGTGGCCTCTGCATTCCAGG + Intergenic
901067949 1:6503481-6503503 TCACTGAACCTCTGCCTCCCGGG + Intronic
901495003 1:9615746-9615768 TCACTTGGCCTCTCCTCGCCAGG - Intergenic
901741068 1:11342385-11342407 ACACATGGCCTCTGCACACCAGG + Intergenic
902378442 1:16041440-16041462 TCACTTGGCCACTCCATGCCGGG - Intergenic
902864705 1:19270421-19270443 GACCTTGGCCTCTGCAGCCCCGG + Intergenic
902866928 1:19285858-19285880 GACCTTGGCCTCTGCAGCCCTGG + Intronic
902869975 1:19308128-19308150 GACCTTGGCCTCTGCAGCCCCGG + Intronic
904550921 1:31317098-31317120 TCACTCAACCTCTGCTTCCCAGG + Intronic
905603413 1:39273671-39273693 TCACTGAACCTCTGCCTCCCGGG + Intronic
905662854 1:39740667-39740689 GTTCTTGGCCTCTGCACCCCTGG + Intronic
905983828 1:42257661-42257683 TCACTGCACCTCTGCCTCCCAGG - Intronic
906465269 1:46073258-46073280 TCACTTGGCCTCTGCTACCCTGG + Intronic
908991881 1:70101582-70101604 TTACCTAGCCTCTACATCCCTGG - Intronic
909095129 1:71276963-71276985 TCACTGCACCTCTGCCTCCCAGG + Intergenic
909210475 1:72816672-72816694 TCTCTTGGTCTCTGCATTCTAGG - Intergenic
909370199 1:74874644-74874666 TAACCTGGCCTCAGCATGCCAGG + Intergenic
910454762 1:87385666-87385688 TCACATTGCATCTGAATCCCAGG + Intergenic
911719440 1:101174387-101174409 TCACTCAACCTCTGCCTCCCGGG - Intergenic
911788773 1:101984470-101984492 TCACTGCACCTCCGCATCCCAGG + Intronic
912350520 1:109008343-109008365 TCACTACACCTCTGCCTCCCAGG + Intronic
912725839 1:112058215-112058237 TCACTTGGCCGCTGCATCTCAGG + Intergenic
913544721 1:119856594-119856616 TCACTGAACCTCTGCCTCCCAGG + Intergenic
917087406 1:171317890-171317912 TCACTTTGCCTCTGAATCCTAGG - Intronic
917467592 1:175295879-175295901 TCACTGCACCTCTGCCTCCCAGG + Intergenic
917917515 1:179718280-179718302 TCACTTGGCTTCTGCATGCTTGG - Intergenic
918465061 1:184812613-184812635 TCTCTTGGTCTCTGCCTTCCAGG + Intronic
919516635 1:198533226-198533248 TCACTGAGCCTCTGCCTCCTGGG - Intronic
919683192 1:200456073-200456095 TCACTGCACCTCTGCCTCCCGGG + Intergenic
919733106 1:200927018-200927040 TCACTAAACCTCTGCCTCCCCGG + Intergenic
920840303 1:209548347-209548369 TCATTTGGCCTCTGTATAGCTGG + Intergenic
921647619 1:217636486-217636508 TCACTGCACCTCTGCCTCCCAGG + Intronic
921822418 1:219632567-219632589 TCACTTGGCCTCAGTTACCCCGG + Intergenic
922361179 1:224822967-224822989 TCACCCAGCCTCTGCCTCCCAGG + Intergenic
922379200 1:225004784-225004806 TTCATTGGCATCTGCATCCCTGG - Intronic
922528110 1:226321814-226321836 TCACTGAGCCTCTGCCTCCCAGG - Intergenic
922947977 1:229533196-229533218 TCACTGAACCTCTGCCTCCCAGG + Intronic
923537352 1:234863367-234863389 TCACTTGGATCCTGCAGCCCAGG - Intergenic
923554233 1:234987970-234987992 TCCCTTGGTCTCTGTCTCCCCGG + Intergenic
923769980 1:236929977-236929999 TCACTTTGCCTGTGCATCTAAGG + Intergenic
924105264 1:240643142-240643164 TCACTGAACCTCTGCCTCCCGGG - Intergenic
1063543963 10:6962067-6962089 TCACTTGCTTTCTGCAGCCCTGG + Intergenic
1064664616 10:17638195-17638217 TCACTAAACCTCTGCCTCCCGGG + Intergenic
1064724225 10:18261125-18261147 TCACTTAGCTTCTGCCTCCTAGG - Intronic
1064748992 10:18506872-18506894 TCACTGCGCCTCTGCCTCCAGGG + Intronic
1065552579 10:26884019-26884041 TCACCTGGCCACTGCAGCCAGGG - Intergenic
1066189912 10:33046764-33046786 TCACTGCACCTCTGCCTCCCGGG - Intergenic
1066576236 10:36828158-36828180 TCACTGCACCTCTGCCTCCCAGG + Intergenic
1066576298 10:36828995-36829017 TCACTGCACCTCTGCCTCCCAGG - Intergenic
1067332913 10:45338430-45338452 CCACTTGGCCTCTGCCACCTTGG - Intergenic
1067872934 10:49978476-49978498 CCACTTGGGCTCTGCACACCAGG - Intergenic
1068837484 10:61570386-61570408 CCACTTGGCCTCTGCCACCTCGG + Intergenic
1069121512 10:64575024-64575046 TCCCTCTGCCTCAGCATCCCAGG - Intergenic
1069475031 10:68724388-68724410 TCACTCAACCTCTGCCTCCCCGG - Intronic
1069824692 10:71247821-71247843 TCACTTGGGTCCTACATCCCAGG - Intronic
1070092390 10:73300783-73300805 TCACTGCACCTCTGCCTCCCAGG - Intronic
1070137517 10:73707777-73707799 CCACTTGGGCTCTGCACACCAGG + Intergenic
1070898724 10:80008733-80008755 TCACCTAACCTCTGCCTCCCAGG - Intergenic
1070953211 10:80447274-80447296 TCACTGGCCCTCTGCAGCCCTGG + Intergenic
1071278454 10:84077533-84077555 TCAGTTCACCTCTGCCTCCCAGG - Intergenic
1071359049 10:84827573-84827595 TGATTTGTCCTCTGCATTCCTGG + Intergenic
1072162759 10:92783855-92783877 TCCCTTGACCTCTGCCACCCTGG + Intergenic
1073350545 10:102816672-102816694 TCACGCAGCCTCTGCCTCCCAGG + Intergenic
1073975845 10:109099786-109099808 TCACTTGGCTTCTGAACTCCTGG - Intergenic
1074562846 10:114549306-114549328 TCACTGCACCTCTGCCTCCCAGG - Intronic
1074651323 10:115527192-115527214 TCACTCAACCTCTGCCTCCCAGG + Intronic
1075027697 10:118998502-118998524 TCCCTGGGCTTCTGCTTCCCTGG - Intergenic
1075405404 10:122192453-122192475 TCCCCTGGCTTCTGCATTCCTGG - Intronic
1075763734 10:124876487-124876509 TCACTGAACCTCTGCCTCCCGGG - Intergenic
1076175745 10:128366615-128366637 TCACTTAGCGTCACCATCCCAGG + Intergenic
1076492702 10:130873844-130873866 CCACTCGGCCTCTGCTGCCCAGG - Intergenic
1076547762 10:131257255-131257277 TCCGTTGGCCTCTGCTTCACGGG - Intronic
1077050856 11:566173-566195 CCACTTGGCCTATGCATTCCAGG - Intergenic
1078210598 11:9266494-9266516 TCACTGCACCTCTGCCTCCCAGG + Intergenic
1079033957 11:17006550-17006572 TCACTGCACCTCTGCTTCCCGGG - Intronic
1079346841 11:19660245-19660267 TCACTCGGCCACTGCATCCCAGG + Intronic
1079410447 11:20182628-20182650 TCACTGGACCTCCGCCTCCCGGG + Intergenic
1080054064 11:27887069-27887091 TCACTTGTTCTCTGCCTCACAGG - Intergenic
1080084629 11:28264570-28264592 TTTCTTGGCTTCTGCATCACAGG - Intronic
1080874636 11:36264701-36264723 TCCCTGGGGCTCTGCAGCCCGGG + Intergenic
1081472180 11:43384577-43384599 TCACTCAACCTCAGCATCCCTGG - Intronic
1081527828 11:43938725-43938747 TCACTGCACCTCTGCCTCCCGGG - Intronic
1081572295 11:44299297-44299319 CTACTTGTCTTCTGCATCCCCGG + Intronic
1083226348 11:61287291-61287313 TCCCTTGGCCTCTTCCTTCCTGG - Intronic
1083664046 11:64265170-64265192 TCACAGGGCCTCTGCTCCCCAGG + Exonic
1085259412 11:75195754-75195776 TCTCTGGGCCTCTGTCTCCCTGG + Intronic
1085685719 11:78620385-78620407 TCTCTTGGCCCCTGCAACCTTGG - Intergenic
1088104146 11:106186656-106186678 TCTCTTGGCCTCTGCCTCTCAGG + Intergenic
1089245273 11:117114697-117114719 TCACTATGCCTCCGCCTCCCAGG - Intergenic
1089458970 11:118641688-118641710 TCCCTGGGCCTCCGCCTCCCGGG + Intronic
1090182992 11:124717262-124717284 TCACTCAACCTCTGCCTCCCAGG - Intergenic
1090417806 11:126552634-126552656 TCACTGAACCTCTGCCTCCCGGG + Intronic
1090973034 11:131659185-131659207 TCACTTGGCCTCAGCTGCCCTGG - Intronic
1091091197 11:132772857-132772879 ACACTCTGCCTCTGCATCCGCGG - Intronic
1091692005 12:2603682-2603704 TGGCTTGGCCTCAGCATCCCAGG + Intronic
1092397106 12:8136487-8136509 TCACTGCACCTCTGCCTCCCAGG - Intronic
1092583969 12:9877181-9877203 TCACTCAACCTCTGCCTCCCAGG - Intergenic
1092883329 12:12904958-12904980 TCACTGCACCTCTGCCTCCCGGG + Intronic
1096590809 12:52658209-52658231 TCCCTTGGGCTCGGCATACCCGG + Intergenic
1096634732 12:52950930-52950952 TCTCTTGGCCCCTCAATCCCTGG - Intronic
1097007187 12:55927828-55927850 TCACTTCGCCGCCGAATCCCCGG - Exonic
1097254226 12:57660067-57660089 TCTCTTGGTCTCTGCCTTCCAGG + Intergenic
1097895218 12:64818512-64818534 TCACTCAACCTCTGCCTCCCTGG + Intronic
1098190360 12:67941654-67941676 GCACATTGCCTCTCCATCCCAGG + Intergenic
1098293920 12:68984977-68984999 TCTCTTGGCCTCTGCCATCCAGG + Intergenic
1098527999 12:71508985-71509007 ACAATTGGCCTCTGCATATCTGG - Intronic
1098672805 12:73252448-73252470 CCACTTGGCCTCTGCCACCTTGG - Intergenic
1100208354 12:92375787-92375809 TCACTGCACCTCTGCCTCCCAGG + Intergenic
1100246985 12:92768130-92768152 TCACTGTACCTCTGCCTCCCAGG - Intronic
1100253430 12:92856854-92856876 TCACTTGACCTCTGGATTTCAGG - Intronic
1101344510 12:103873755-103873777 TAACTTGGCCCCTGCATGCCTGG - Intergenic
1102925194 12:116821115-116821137 TCACCTGGACTCTGCCTCCTGGG + Intronic
1103552192 12:121745934-121745956 TCACTGAACCTCTGCCTCCCGGG + Intronic
1103873066 12:124105225-124105247 TCTCTTGGCCTCAGCTTCCCGGG + Intronic
1104680830 12:130750398-130750420 TCATGTGGCCTCAGCCTCCCAGG - Intergenic
1104785428 12:131445240-131445262 GCCCTTGGCCTCCGCAGCCCAGG - Intergenic
1106463150 13:29990201-29990223 GCACCTGGCCTCTACAGCCCTGG - Intergenic
1107680117 13:42839451-42839473 TTACATGGGCTCTGCTTCCCAGG + Intergenic
1108422536 13:50265726-50265748 TCACCTGGCCTCTGACCCCCTGG + Intronic
1109107123 13:58267638-58267660 TCACTCAACCTCTGCCTCCCTGG + Intergenic
1111109612 13:83689440-83689462 TCACTGCACCTCTGCCTCCCGGG - Intergenic
1111890205 13:94072427-94072449 TCACTGAGCCTCTGCCTCCCGGG + Intronic
1112562425 13:100526276-100526298 TCACGTGGCATCTGCATTCCAGG - Intronic
1112923281 13:104641698-104641720 TCACTTGGCCTTTGCCTACCAGG - Intergenic
1113035688 13:106046283-106046305 TCACTCCACCTCTGCCTCCCGGG + Intergenic
1113312931 13:109149793-109149815 TCACGTGTGCTGTGCATCCCTGG - Intronic
1113932955 13:113978081-113978103 ACACCTGCCGTCTGCATCCCGGG + Exonic
1114328228 14:21611348-21611370 TCACTGCACCTCTGCCTCCCGGG + Intergenic
1115242868 14:31266953-31266975 TCACTGCACCTCTGCCTCCCAGG + Intergenic
1115430655 14:33314554-33314576 TCAGTTGGCCTCTGAATACATGG + Intronic
1116158620 14:41238477-41238499 TCACTTGGCCTCTGCCACCTAGG + Intergenic
1118504835 14:66399912-66399934 TCCCTTGGCCTCTACATTCAGGG + Intergenic
1118744273 14:68762734-68762756 TCACTTGGCCTCTGGGGCTCTGG - Intergenic
1119356911 14:74015004-74015026 TCACTTCAACTCTGCCTCCCAGG - Intronic
1119436426 14:74600584-74600606 TCACTTGGGCCCTCCAGCCCTGG - Intronic
1119998659 14:79279383-79279405 TCACTTCACCTGTGCCTCCCTGG + Intronic
1121252509 14:92510494-92510516 TCACTGAACCTCTGCCTCCCAGG - Intergenic
1121550892 14:94799145-94799167 TCTCTTGCCCTCTGCCTCCCAGG - Intergenic
1122558975 14:102597707-102597729 TCACACAGCCTCTGCCTCCCGGG + Intronic
1122672482 14:103383428-103383450 TCACTTCAACTCTGCCTCCCAGG + Intergenic
1123143899 14:106109357-106109379 TCATTTTGCTTCTGCACCCCAGG - Intergenic
1123664586 15:22598472-22598494 TCGCCGGGCCTCTGCCTCCCCGG + Intergenic
1123664746 15:22599399-22599421 TCACTGGGCCTCTGCCTCCTGGG + Intergenic
1123684772 15:22789066-22789088 TCACTGAACCTCTGCCTCCCGGG + Intronic
1123994234 15:25707035-25707057 CCACTGGGCCCCTGGATCCCGGG + Intronic
1124318420 15:28692905-28692927 TCGCCGGGCCTCTGCCTCCCCGG + Intergenic
1124318578 15:28693834-28693856 TCACTGGGCCTCCGCCTCCTGGG + Intergenic
1124403753 15:29375740-29375762 CCACCTGGCCCCTGCAACCCTGG - Intronic
1124564867 15:30803612-30803634 TCACTGGGCCTCCGCCTCCCCGG - Intergenic
1124565020 15:30804523-30804545 TCGCCGGGCCTCTGCCTCCCGGG - Intergenic
1125078713 15:35651499-35651521 TCAGTTGGCACCTGCTTCCCTGG + Intergenic
1125401800 15:39312046-39312068 ACACTTGAGCTCTGCCTCCCCGG + Intergenic
1127612407 15:60649837-60649859 TAACTTGGCCTTTGTATCTCTGG + Intronic
1127970451 15:63955641-63955663 TCACGTGGCCTCTGCCTCCAGGG + Intronic
1128103345 15:65024248-65024270 TCACTGCACCTCTGCCTCCCAGG - Intronic
1128295044 15:66511689-66511711 TCACTGTACCTCTGCCTCCCAGG + Intronic
1128406076 15:67340350-67340372 TCACTGTACCTCTGCCTCCCGGG - Intronic
1128652275 15:69426643-69426665 TCACTGTACCTCTGCCTCCCAGG - Intronic
1129000632 15:72330382-72330404 TCACTGAACCTCTGCCTCCCAGG - Intronic
1129899797 15:79137887-79137909 TGAGTTGGCCTCGGCTTCCCTGG + Intergenic
1130332649 15:82934034-82934056 TCAGCAGGCCTCAGCATCCCTGG + Intronic
1131002598 15:88950737-88950759 TCTCTTGGCCCCTGCACCACTGG + Intergenic
1132195328 15:99910173-99910195 TCACTTGGTCCTTGCAACCCAGG + Intergenic
1132746064 16:1436811-1436833 TCACTGGGCATCTGTACCCCAGG - Exonic
1133103092 16:3491013-3491035 CCACCTGGCCTCTGCGTCTCTGG + Intergenic
1133105999 16:3509900-3509922 TCGCTGCGCCTCTGCCTCCCAGG + Intronic
1133109192 16:3535632-3535654 TCACTGCACCTCTGCCTCCCAGG + Intronic
1133134953 16:3704267-3704289 TCACTGAACCTCTGCCTCCCAGG - Intronic
1133300305 16:4778382-4778404 ACACTCGGCCTCTGTATCCATGG + Intronic
1133816717 16:9203295-9203317 TCACTTTGTCTCTGTTTCCCTGG + Intergenic
1134367393 16:13592027-13592049 TCACTATACCTCTGCCTCCCAGG + Intergenic
1135333038 16:21576797-21576819 TCACTGCACCTCTGCCTCCCAGG - Intergenic
1135961614 16:26999422-26999444 TCACGTGGCTTCTGCATCACAGG - Intergenic
1136746877 16:32598293-32598315 TGCCTTGGCCTCATCATCCCAGG + Intergenic
1136872333 16:33818911-33818933 TCACTTCACCTCTGCCTCCCAGG - Intergenic
1137324556 16:47421378-47421400 TCACTGAACCTCTGCCTCCCAGG + Intronic
1138461378 16:57149971-57149993 TCACTTAGCCTCCGCCTCCTGGG + Intergenic
1139635052 16:68253449-68253471 TCACTACACCTCTGCCTCCCAGG + Intronic
1139884119 16:70196807-70196829 TCCCCTGCCCTCTGCTTCCCTGG + Intergenic
1139910015 16:70391947-70391969 TCTCTTGGCCTCACCATCTCTGG - Intronic
1140327292 16:74017185-74017207 CCACTTAGCCTCTGCCACCCTGG + Intergenic
1140368399 16:74398689-74398711 TCCCCTGCCCTCTGCTTCCCTGG - Intergenic
1141102666 16:81209377-81209399 TCCCTTGGCCACTGGCTCCCAGG + Intergenic
1141298096 16:82788777-82788799 TCACCTGGGCTCCACATCCCAGG - Intronic
1141641024 16:85341580-85341602 TCACTGCACCTCTGCCTCCCGGG - Intergenic
1141749736 16:85950278-85950300 TCCCTCGGCCTCTGCATGCTTGG - Intergenic
1141848406 16:86626921-86626943 TCACTTGGCAGCTGCACCCTGGG - Intergenic
1142433678 16:90043989-90044011 TCTCCTGGCCTCTCCATCTCAGG - Exonic
1203049007 16_KI270728v1_random:857497-857519 TGCCTTGGCCTCATCATCCCAGG + Intergenic
1203099839 16_KI270728v1_random:1297157-1297179 TCACTTCACCTCTGCCTCCCAGG + Intergenic
1142650809 17:1350515-1350537 TCACTGCACCTCTGCCTCCCGGG + Intronic
1142890052 17:2937355-2937377 CCCCTTGGCCACAGCATCCCAGG - Intronic
1143079155 17:4368614-4368636 TCACTGCACCTCTGCCTCCCTGG + Intergenic
1143207791 17:5157704-5157726 TCACTGCACCTCTGCCTCCCAGG + Intronic
1144177806 17:12723936-12723958 TCATGTGGCCTCTGAATCGCAGG - Intronic
1145300495 17:21631878-21631900 TCACTGAACCTCTGCCTCCCAGG + Intergenic
1145318166 17:21747340-21747362 TCACTTGGTGTCTCCTTCCCAGG - Intergenic
1145752222 17:27363267-27363289 ACATTTGTCCTCTGCCTCCCTGG - Intergenic
1145928286 17:28664428-28664450 TCACTGCACCTCTGCCTCCCTGG - Intronic
1146035457 17:29402376-29402398 TCACTGTGCCTCTACTTCCCGGG + Intronic
1146627952 17:34448224-34448246 TCACTTAGCCTCTCTGTCCCTGG - Intergenic
1146717129 17:35095720-35095742 TCACTGCACCTCTGCCTCCCGGG - Intronic
1147034156 17:37667637-37667659 TCACTGCACCTCTGCCTCCCGGG + Intergenic
1147417092 17:40300036-40300058 TCACTGCACCTCTGCCTCCCGGG + Intronic
1147650342 17:42058437-42058459 ACACTTAGCCTCAGCCTCCCTGG + Intronic
1147749945 17:42724708-42724730 TCACTCAACCTCTGCCTCCCAGG - Intronic
1147779524 17:42930365-42930387 TCACTGAACCTCTGCCTCCCAGG - Intergenic
1147791680 17:43017805-43017827 TCACATGCTCTCTCCATCCCTGG + Intronic
1148041852 17:44713572-44713594 TCACTACACCTCTGCCTCCCGGG - Intronic
1148243684 17:46016314-46016336 TCACTCAGCCTCTGCCTCCTGGG - Intronic
1148965236 17:51429443-51429465 TCTCTGTGCCTGTGCATCCCTGG + Intergenic
1149113429 17:53062578-53062600 TCACTGCGCCTCCGCCTCCCGGG + Intergenic
1149872579 17:60196189-60196211 TCACTGCACCTCTGCCTCCCAGG - Intronic
1150362932 17:64553428-64553450 TCACTGCACCTCTGCCTCCCAGG - Intronic
1151296403 17:73189599-73189621 TTCCTTGTCCTCTGCCTCCCAGG - Intergenic
1151540178 17:74760781-74760803 TCACTGGGCCTCAGCAACCCTGG + Intronic
1152089493 17:78238932-78238954 AGACATGGCCTCAGCATCCCCGG - Intronic
1152173635 17:78771185-78771207 TCTCTTAACCTCTGCCTCCCAGG - Intronic
1152378898 17:79932064-79932086 TCACGTGTCCTCTACATCCTGGG + Intergenic
1152590913 17:81211562-81211584 GGACTTGGCGTCTGCCTCCCAGG - Intronic
1153102399 18:1488438-1488460 ACACATGGCCCCTGCATCTCAGG - Intergenic
1153228095 18:2912872-2912894 TAAGGTGGCCTCTGCATCACGGG + Intronic
1155320298 18:24612336-24612358 CAACTGGGCCTCTGCAGCCCTGG + Intergenic
1155582396 18:27324471-27324493 TCACTTGGCCTTTGCTGACCTGG - Intergenic
1155809570 18:30215035-30215057 TCACTGCACCTCTGCCTCCCAGG - Intergenic
1156537552 18:37878723-37878745 CCACTTGGCCTCTGCCACCTAGG - Intergenic
1157328599 18:46686715-46686737 TCACTGGGCCTGTCCATCCAGGG - Intronic
1157591661 18:48839836-48839858 TCACTGGGGGGCTGCATCCCAGG + Intronic
1160065859 18:75573775-75573797 ACACTGGGCCCCTGTATCCCCGG + Intergenic
1160963859 19:1737023-1737045 GCACTTGGCCGCTGAAGCCCAGG + Intergenic
1161613126 19:5254760-5254782 ACACTATGCCTCTGCCTCCCAGG - Intronic
1161659252 19:5536086-5536108 ACACTTGCCCTCTTCCTCCCAGG + Intergenic
1161943313 19:7419247-7419269 ACACTCGGCCTCCGCACCCCAGG + Intronic
1161943479 19:7419921-7419943 ACACTCGGCCTCTGTACCCCAGG + Intronic
1161943499 19:7420000-7420022 ACACTCGGCCCCTGCACCCCAGG + Intronic
1162106551 19:8373327-8373349 TCACTGCACCTCTGCCTCCCAGG - Intronic
1162690027 19:12421813-12421835 TCACTCAACCTCTGCTTCCCAGG - Intronic
1164001759 19:21106900-21106922 TCACTGCACCTCTGCCTCCCGGG + Intronic
1166108852 19:40610817-40610839 TCACTTGGCCTCTGCATCCCAGG - Intronic
1166947006 19:46403572-46403594 TCACTGCCCCTCTGCCTCCCGGG - Intergenic
1167639116 19:50670639-50670661 TCACTTGGCCCCTGCTACACAGG + Intronic
1167766625 19:51487397-51487419 TCACTGAGCCTCTGCCTCTCGGG - Intronic
925315690 2:2921470-2921492 TCATGTGGCCTCTGCTTTCCTGG - Intergenic
925415280 2:3666094-3666116 TCCCGTGCCCTCTGCTTCCCAGG + Intronic
926040112 2:9666123-9666145 TGACGTGGCCATTGCATCCCAGG - Intergenic
926210105 2:10863073-10863095 GCCCTGGGCCTCTGCATTCCCGG + Intergenic
926238596 2:11068243-11068265 TCACCCGGTCTCAGCATCCCAGG - Intergenic
927156259 2:20223526-20223548 GCACCTCCCCTCTGCATCCCTGG + Intronic
928157393 2:28889002-28889024 TCACTGGACCTCCGCCTCCCAGG - Intergenic
929682168 2:44002778-44002800 TCACTCAACCTCTGCCTCCCAGG - Intergenic
930032849 2:47069062-47069084 TGGCTAGGCCTCTGGATCCCGGG - Intronic
930837737 2:55812438-55812460 GCACTTGGCCACTGCCTCTCAGG - Intergenic
931521539 2:63102963-63102985 TCACTCAACCTCTGCCTCCCAGG + Intergenic
931563878 2:63593173-63593195 TCACTCAACCTCTGCCTCCCGGG + Intronic
931706897 2:64953837-64953859 TCGCATGGCCTCTGCATGCTAGG + Intergenic
931801939 2:65767007-65767029 TGACTTAGCCTCTGCATCTCAGG + Intergenic
931964798 2:67521553-67521575 TCACAGGGCCTCTGCATCTCAGG - Intergenic
932190841 2:69740755-69740777 TTACTGAGCCTCTGCCTCCCGGG + Intronic
932701409 2:73994711-73994733 TCACTCACCCTCTGCCTCCCAGG + Intronic
932965846 2:76473754-76473776 TCTCTTGGTCTCTGCCTTCCAGG + Intergenic
933159235 2:79006085-79006107 TCTCTTGGCCTCTCATTCCCAGG + Intergenic
933614320 2:84468844-84468866 TCTCTTGGTCTCTGCCTTCCAGG - Intergenic
934888981 2:98049080-98049102 TCTCTTGGTCTCTGCCTTCCAGG + Intergenic
934964372 2:98707137-98707159 TCACTGTACCTCTGCCTCCCAGG - Intronic
935469364 2:103438489-103438511 TCACTACACCTCTGCCTCCCAGG + Intergenic
937036762 2:118788617-118788639 AATCTTGGCCTCTGCCTCCCGGG + Intergenic
937240256 2:120456201-120456223 TCACTCAACCTCTGCCTCCCGGG + Intergenic
938408871 2:131047561-131047583 TTTCTGGGCCTCAGCATCCCTGG + Intergenic
938672723 2:133601109-133601131 TCACTCAGCCTCAGCCTCCCAGG + Intergenic
940171559 2:150834526-150834548 CCACTTGGCCCCTGCCACCCTGG + Intergenic
941159340 2:162018300-162018322 TCACTTGGCCACTCCTTGCCTGG + Intronic
941824853 2:169883906-169883928 TCACTGAACCTCTGCTTCCCAGG + Intronic
942261234 2:174166048-174166070 TCATGTGACCTCTGCCTCCCGGG - Intronic
942325219 2:174770655-174770677 TCACTGCACCTCTGCCTCCCAGG + Intergenic
942652579 2:178184052-178184074 CCCCTTAGCCTCAGCATCCCAGG - Intergenic
943209193 2:184940728-184940750 TCAATTGGGCTCTGAAACCCTGG - Intergenic
943509245 2:188803489-188803511 TCACTTGGCCCCTGCCACCTCGG - Intergenic
943517837 2:188909043-188909065 CCACTTGGCCTCTGCCTCCTTGG + Intergenic
944723447 2:202446724-202446746 TCACTGAGCCTCTACCTCCCAGG + Intronic
946439606 2:219684360-219684382 TCCCTCGGCCTCTGCTTCCTCGG + Intergenic
947133439 2:226953507-226953529 CCACATGGCCTCTCAATCCCTGG + Intronic
947739689 2:232479451-232479473 GCCCTTGGCCTCAGCCTCCCTGG - Intergenic
948625678 2:239266488-239266510 TCATTTGTCCTCAGCAGCCCCGG - Intronic
948664641 2:239527209-239527231 TGTCTTGGCGTCTGCCTCCCGGG - Intergenic
948886630 2:240888167-240888189 TGACCTGGCCTCAGCATTCCTGG + Intronic
1169134081 20:3185927-3185949 TCACTGCACCTCTGCCTCCCAGG - Intergenic
1169735959 20:8837853-8837875 CCACTTGGCCCCTGCCACCCTGG - Intronic
1171015770 20:21540625-21540647 GAACTTTGCCTCTGGATCCCAGG + Intergenic
1171456443 20:25275318-25275340 TCACGTGGCCTCTGCGTGCCTGG - Intronic
1172047923 20:32093928-32093950 CATCTTGGTCTCTGCATCCCTGG + Exonic
1172275443 20:33676675-33676697 TCACCTTGTCTCTGCAGCCCTGG - Exonic
1173792961 20:45840217-45840239 ACACCTGGCCTCCACATCCCTGG - Intronic
1174536185 20:51253395-51253417 TGACCTGGCCCCTTCATCCCAGG + Intergenic
1175266260 20:57705291-57705313 ACAGTTGGCCTCAGCTTCCCAGG - Intronic
1175761750 20:61566060-61566082 TCGCTGGTCCTCTGCTTCCCTGG + Intronic
1176077745 20:63256058-63256080 GCACTGGGCCTCTGCTTACCCGG - Intronic
1178536828 21:33416993-33417015 TCACTGGACCTCCGCCTCCCAGG + Intronic
1178688341 21:34729344-34729366 TCACTCAACCTCTGCTTCCCAGG + Intergenic
1179219886 21:39396609-39396631 TCACTGCACCTCTGCCTCCCGGG - Intronic
1181468484 22:23123550-23123572 CCCCTTGGCCTCTGCCTCCTTGG + Exonic
1181568595 22:23754105-23754127 TCACTGCACCTCTGCCTCCCAGG - Intronic
1182316096 22:29448472-29448494 TCACCTGGGCCCTGCCTCCCTGG + Intergenic
1182645091 22:31802202-31802224 TCACTGCGCCTCTGCCTCCTGGG + Intronic
1182743369 22:32585238-32585260 TCCCTGGGCCTCTGCTTCTCTGG - Intronic
1183225221 22:36545193-36545215 ACCCTTGGGCTCTGCATCCAGGG - Intergenic
949232286 3:1765547-1765569 TCTCTTTCCCTCTTCATCCCTGG + Intergenic
949620117 3:5801310-5801332 TCACATGGCCTCTGCAACCATGG - Intergenic
949863023 3:8523795-8523817 TCACCTTCCCTCAGCATCCCTGG + Intronic
950186331 3:10947917-10947939 TCACTTTGCATCAGCAACCCTGG - Intergenic
950428507 3:12937669-12937691 GCCCTTGGCCTCTGTCTCCCAGG - Intronic
950546684 3:13642262-13642284 TCACCTGGGCTTTGCCTCCCTGG - Intergenic
950791414 3:15475242-15475264 TCCCTATGCCCCTGCATCCCAGG + Intronic
950794702 3:15501437-15501459 TGTCTTTGCCTCTGGATCCCTGG - Intronic
951970992 3:28443668-28443690 TCACTTGGCCTCTGCCACCTTGG + Intronic
951978611 3:28541863-28541885 CCACTTGGCCTTTGCCACCCAGG - Intergenic
952887013 3:38018181-38018203 TCACCTGGCCTCTGTTTTCCAGG + Intronic
953313498 3:41903507-41903529 TCATTGCGCCTCTGCCTCCCGGG - Intronic
953968779 3:47331200-47331222 TCACTGCACCTCTGCCTCCCGGG + Intronic
954313539 3:49787960-49787982 TCACTGAACCTCTGCCTCCCAGG - Intergenic
955211282 3:56943837-56943859 TCACTGCACCTCTGCCTCCCCGG - Intronic
956625096 3:71259067-71259089 TCACTGCACCTCTGCCTCCCAGG - Intronic
956719258 3:72103605-72103627 TCACTGAACCTCTGCCTCCCGGG + Intergenic
960151088 3:114249629-114249651 TCACATGGCCTCTCCATCCTGGG - Intergenic
960959857 3:123062653-123062675 TCCCTTGCCCTCTGTTTCCCTGG + Intergenic
961192774 3:124976260-124976282 TCACTGCACCTCTGCCTCCCAGG + Intronic
961338090 3:126197011-126197033 TCTCTTGGTCTCTGCCTTCCAGG - Intronic
961518828 3:127455498-127455520 GCACTTCCCCTCTCCATCCCTGG - Intergenic
962319981 3:134382251-134382273 GCCCTGGGCCTCTGCAACCCAGG - Intergenic
962743108 3:138377617-138377639 TCCCTGGGCATCTGGATCCCAGG + Intronic
963098113 3:141567338-141567360 TCACTGAACCTCTGCCTCCCGGG - Intronic
964440874 3:156707772-156707794 TCACTGTACCTCTGCATCCTGGG - Intergenic
964468749 3:157028589-157028611 TCACTTAGCCTCTCCAGACCTGG + Intronic
965391518 3:168110237-168110259 TCACTTTGCCCCTGCCACCCTGG + Intergenic
965528766 3:169749608-169749630 TCTTTTCGCCTCTGCCTCCCTGG - Intergenic
965585888 3:170318057-170318079 TCTCTTGGTCTCTGCCTTCCAGG - Intergenic
967816327 3:193801895-193801917 TCACTCAGCCTCTACCTCCCAGG + Intergenic
968202949 3:196771632-196771654 TCACTGTACCTCTGCCTCCCAGG + Intronic
968269847 3:197394976-197394998 TCACTTGGCCCCTGCTCCCGAGG - Intergenic
968654046 4:1771058-1771080 TCACTTGCCCTTTGCCTCTCAGG - Intergenic
968673589 4:1865142-1865164 TCACTGTACCTCTGCCTCCCAGG + Intergenic
969203150 4:5621996-5622018 TCACCTGGCCCTTTCATCCCTGG - Intronic
969307792 4:6335676-6335698 ACACCTGGGCTCTGCAGCCCTGG - Intronic
969441033 4:7216897-7216919 TCACTCCGCTTCTGCATCCCCGG - Intronic
970341995 4:15117048-15117070 ACAGTTGGTCTCTGAATCCCAGG - Intergenic
971910746 4:32793668-32793690 TCACTTCACCTCTACCTCCCGGG - Intergenic
972533444 4:39980275-39980297 TCACTTCACCTCTGCCTCCCAGG + Intergenic
972535365 4:39995582-39995604 TCACTGCACCTCTGCCTCCCAGG - Intergenic
973540166 4:51927567-51927589 CCACTTGGCCCCTGCCTCCCTGG + Intergenic
974178855 4:58359684-58359706 ACACTTTGCCTCTCCATGCCTGG - Intergenic
974262605 4:59544084-59544106 TCACTTGGCCCCTGCCACCTCGG + Intergenic
975900076 4:79141215-79141237 TAACTTGGCCACTCCAGCCCAGG - Intergenic
976273230 4:83250759-83250781 TCACTTTGACTCTGCCTCTCTGG + Intergenic
976984067 4:91270667-91270689 TCTTTTGGCCTCTGCATCCCAGG - Intronic
977701982 4:100031703-100031725 TCACTTGGCCTCTGCCACCTTGG + Intergenic
978514447 4:109556681-109556703 TCACATTGCCTCTACATACCAGG - Intergenic
980231666 4:130053293-130053315 TCACTAGACCTCTACCTCCCAGG + Intergenic
980406126 4:132355607-132355629 CCACTTGGCCTCTGCCACCTTGG + Intergenic
981091430 4:140736463-140736485 TCACTGCACCTCTGCCTCCCGGG - Intronic
981170485 4:141617026-141617048 TAATTTGGCCTCTGCATCAGGGG - Intergenic
981834615 4:149040658-149040680 CCACTTGGCCTCTGCCACCTTGG - Intergenic
984650441 4:182264411-182264433 TCTCTTGGTCTCTGCCTTCCAGG + Intronic
984968888 4:185168529-185168551 GCACTCTGCCTCTGCCTCCCAGG - Intronic
984982868 4:185300232-185300254 TCACTGGACCTCTGCCTCCAGGG + Intronic
985877180 5:2609000-2609022 TCACTTCAACTCTGCCTCCCAGG - Intergenic
986006372 5:3672266-3672288 TCACTTGGCCCCACCAGCCCCGG - Intergenic
986015655 5:3754832-3754854 TCTCTTGCCCGCTGCATACCTGG + Intergenic
986212304 5:5685564-5685586 TTTCTTGGCCTCTGCTGCCCTGG + Intergenic
987091869 5:14515314-14515336 TCACTCAGCCTCTGCCTCCCGGG + Intronic
987286406 5:16462231-16462253 TCACTTGGTCTATGCATGCCTGG + Intronic
987532963 5:19144817-19144839 TCACTGAACCTCTGCCTCCCAGG + Intergenic
989192739 5:38687079-38687101 TCACTGAACCTCTGCCTCCCAGG + Intergenic
989481565 5:41936456-41936478 TCACGTAACCTCTGCCTCCCAGG - Intronic
989539219 5:42599435-42599457 TCACTCAACCTCTGCCTCCCGGG + Intronic
989722616 5:44547742-44547764 TCACTGCACCTCTGCCTCCCGGG + Intergenic
991385034 5:66077884-66077906 TTACTTTGCCTCTCCATGCCTGG + Intronic
991962977 5:72064170-72064192 TCACTAAGCCTCTGCATGACTGG - Intergenic
992104938 5:73442721-73442743 TCACTTGTCCTCTGCTCTCCAGG + Intergenic
992222654 5:74588056-74588078 GCACTTTGCCTCAGCATCACAGG - Intergenic
992254032 5:74903689-74903711 TCTGTTGGCCTCTCCATACCTGG + Intergenic
992555265 5:77896827-77896849 TCACTGCACCTCTGCCTCCCAGG - Intergenic
994938290 5:106285199-106285221 CCACTTAGCCTCTGTATCCTAGG + Intergenic
995082960 5:108075549-108075571 TCACTCAACCTCTGCCTCCCGGG + Intronic
995468914 5:112479697-112479719 TCTCCTGGCCTCTGCATCTTGGG - Intergenic
995709184 5:115017435-115017457 TCACGTGACCTCTGCTTCCCAGG - Intergenic
997290603 5:132730717-132730739 TCACTTAGCGTCTACCTCCCGGG - Intronic
997709704 5:135993614-135993636 TCAGATGGCCTCTGGCTCCCTGG - Intergenic
998460364 5:142305423-142305445 TCACTCAGCCTCTGCCTCCCAGG + Intergenic
998533455 5:142907122-142907144 TCACTTCCACTCTGCATCTCTGG + Intronic
998699483 5:144681624-144681646 TCTCTTGGCTTCTGCTACCCTGG - Intergenic
1000529907 5:162406616-162406638 TCCCTTTGCCTCTGCCTCCCTGG - Intergenic
1001114128 5:168924533-168924555 TCACTCTGCCTCTGCCACCCAGG + Intronic
1001135922 5:169102634-169102656 ACACTTGTCCTCTGTATCCATGG - Intronic
1001258747 5:170206878-170206900 CCACATTACCTCTGCATCCCTGG - Intergenic
1001273913 5:170336511-170336533 TGCCTTGACCTGTGCATCCCGGG + Intergenic
1001517558 5:172366443-172366465 TCTTTTGGCCACTTCATCCCTGG + Intronic
1001625573 5:173129899-173129921 TCACTGCACCTCTGCCTCCCAGG + Intronic
1001661385 5:173396170-173396192 TTACTGGGCCTTTGCAACCCGGG + Intergenic
1002098202 5:176844401-176844423 TCCCCTGGCCTCTCCTTCCCTGG - Intronic
1005934782 6:30512556-30512578 TCACTGCGCCTCCGCCTCCCGGG - Intergenic
1006164646 6:32057175-32057197 CCACTCGGCCTCTGCACCCCTGG + Intronic
1006168749 6:32081203-32081225 TCTCCTGTCCTCTGCATGCCAGG - Intronic
1006310867 6:33258309-33258331 TCACTGCACCTCTGCCTCCCGGG - Intronic
1006460291 6:34154148-34154170 GCACTTGACCTCTCCAGCCCAGG + Intronic
1006961140 6:37931467-37931489 TCACTGCACCTCTGCCTCCCAGG - Intronic
1007044963 6:38763729-38763751 TCACTCAGCCTCAGCCTCCCAGG - Intronic
1007185330 6:39966669-39966691 CCACTTGGCCTCTGCTGGCCTGG - Intergenic
1007953222 6:45891558-45891580 TCACTGAACCTCTGCCTCCCGGG - Intergenic
1008495659 6:52131300-52131322 TCACTTAACCTCTGCCTCCAAGG + Intergenic
1008502734 6:52199670-52199692 TCACTACACCTCTGCCTCCCAGG - Intergenic
1010419527 6:75656137-75656159 TCACTCAACCTCTGCCTCCCAGG - Intronic
1011471845 6:87716041-87716063 TCACTCAGCCTCAACATCCCGGG - Intergenic
1012730232 6:102872509-102872531 CCACTTGGCCTCTTCCACCCAGG - Intergenic
1013488178 6:110618206-110618228 TCACTGCACCTCTGCCTCCCAGG + Intronic
1013817067 6:114111512-114111534 TCTTTTGGCCTCTGCCTCCCTGG + Intronic
1013992201 6:116265985-116266007 TCACGCGGCCTCTGGAACCCTGG - Intronic
1016486976 6:144551863-144551885 TCTCTTGGCCTTTTCTTCCCAGG + Intronic
1016532157 6:145070961-145070983 TTATTTGTCCTCTGCCTCCCAGG + Intergenic
1016667323 6:146657248-146657270 TCACTCAACCTCTGCCTCCCGGG - Intronic
1016966389 6:149722021-149722043 TCACTGCACCTCTGCCTCCCAGG + Intergenic
1017455063 6:154594096-154594118 TCACTCAGCCTCTGCCTCCCAGG - Intergenic
1019271244 7:150251-150273 ACACCTGGCCTCTCCTTCCCTGG - Intergenic
1020381637 7:7554058-7554080 CCAGTTGGCCTCTGGCTCCCTGG - Intergenic
1020612619 7:10419355-10419377 TCACCTGGGGTCTGCCTCCCAGG + Intergenic
1021896365 7:25239760-25239782 TCACTCAACCTCTGCCTCCCGGG + Intergenic
1023276307 7:38522435-38522457 TCACTCTGCCTGTGCATCACAGG - Intronic
1023410717 7:39886634-39886656 TCACTGAACCTCTGCCTCCCGGG + Intergenic
1023976334 7:45032963-45032985 TCACTTAACTTCTGCCTCCCCGG - Intronic
1025841680 7:65155196-65155218 CCACTGCGCCTCTGCCTCCCGGG - Intergenic
1025881368 7:65540780-65540802 CCACTGCGCCTCTGCCTCCCGGG + Intergenic
1025892071 7:65661835-65661857 CCACTGCGCCTCTGCCTCCCGGG - Intergenic
1026733606 7:72933276-72933298 TCACTTGACCTCTGCCTTTCAGG - Intronic
1026783889 7:73287829-73287851 TCACTTGACCTCTGCCTTTCAGG - Intergenic
1026907824 7:74072911-74072933 TCACTCAACCTCTGCCTCCCGGG + Intergenic
1027110428 7:75434348-75434370 TCACTTGACCTCCGCCTTCCAGG + Intronic
1027736354 7:81937406-81937428 TCACAGGGCCACTCCATCCCAGG - Intergenic
1029382200 7:100221544-100221566 TCACCTGGCTTCTGCCTCCCAGG - Intronic
1029402357 7:100353994-100354016 TCACCTGGCTTCTGCCTCCCAGG - Intronic
1029713634 7:102313834-102313856 TCACTTTGCCTCTGCCTCCTGGG - Intronic
1030124276 7:106139742-106139764 TCAGGTGGCCTCTCCAGCCCAGG - Intergenic
1031254296 7:119428341-119428363 TCTCCTGGGCACTGCATCCCAGG - Intergenic
1031463324 7:122078534-122078556 TCACTGTACCTCTGCCTCCCAGG - Intronic
1031498501 7:122481954-122481976 TCACTGAACCTCTGCCTCCCAGG - Intronic
1031742928 7:125456903-125456925 TCTCTTGGTCTCTGCCTTCCAGG - Intergenic
1032538595 7:132684985-132685007 TCTCTTGTCCTCGGCCTCCCAGG - Intronic
1033124480 7:138695856-138695878 TCACTGAGCCTCTGCCTCCTGGG + Intronic
1033551306 7:142450887-142450909 TCTCCTGGCCTCTCCCTCCCTGG + Intergenic
1033977205 7:147116709-147116731 TCCCTTGGTCACTCCATCCCAGG + Intronic
1034929327 7:155149043-155149065 TCACTTTGCCACTGGCTCCCTGG - Intergenic
1034988034 7:155529576-155529598 TCACTGCCCCTCTGCCTCCCAGG + Intronic
1035133161 7:156674598-156674620 TCACTCAGCCTCGGCCTCCCGGG - Intronic
1035292524 7:157848903-157848925 TCACTTGGCCGCTGCCACCCTGG + Intronic
1035297744 7:157876735-157876757 TCACATGGCCCCTGCACCCCAGG + Intronic
1035695097 8:1590091-1590113 ACCCTCGGCCTCTGCCTCCCAGG + Intronic
1037317466 8:17612444-17612466 TCACTGCACCTCTGCCTCCCGGG + Intronic
1037882022 8:22578249-22578271 CCACTTGGCCTCTGGCTGCCAGG - Intergenic
1038194780 8:25357451-25357473 TCACTGCGTCTCTGCCTCCCAGG + Intronic
1038452997 8:27651711-27651733 ACACTTGACATCTGTATCCCAGG + Intronic
1039009798 8:33080681-33080703 TCCCTTCCCCTCTGCATTCCAGG + Intergenic
1039107843 8:34008661-34008683 ACACTTGGCCTCTGTATCCATGG + Intergenic
1039412073 8:37363247-37363269 TCACATGGGCCCTGCCTCCCTGG - Intergenic
1039449286 8:37658795-37658817 TCACATGGCCTGTGTCTCCCAGG + Intergenic
1039798251 8:40933380-40933402 TCCCTTGTTCTCTGCCTCCCAGG + Intergenic
1040009816 8:42652138-42652160 TCACTGCACCTCTGCCTCCCGGG + Intergenic
1040467347 8:47707176-47707198 TCACTCAACCTCTGCCTCCCAGG - Intronic
1040916379 8:52569646-52569668 CCACTTGGCCCCTGCCTCCCTGG + Intergenic
1042912252 8:73839805-73839827 TCACTCAGCCTCTACTTCCCGGG + Intronic
1043826783 8:84938669-84938691 TCTCTTGGTCTCTGCCTTCCAGG + Intergenic
1044032866 8:87260235-87260257 TCTCTTGGTCTCTGCCTTCCAGG - Intronic
1044059873 8:87622855-87622877 TCACTGCACCTCTGCCTCCCGGG - Intergenic
1044780261 8:95736136-95736158 TCACTCGGCCTATTCTTCCCAGG + Intergenic
1045653577 8:104365356-104365378 TCAATTGGCCTCTAGTTCCCAGG - Intronic
1046615218 8:116469811-116469833 TTACTTGGTCTCTGCATACTGGG - Intergenic
1046787259 8:118281382-118281404 TCTCATGGCATCTGCATTCCAGG - Intronic
1048933792 8:139338810-139338832 CCACTTATCCTCTGAATCCCAGG - Intergenic
1050546520 9:6714297-6714319 TCCTTTGGCCTCAGCCTCCCTGG - Intergenic
1051477017 9:17518996-17519018 TCACTGAACCTCTGCCTCCCGGG + Intergenic
1052521126 9:29549352-29549374 TCTCTTGGTCTCTGCCTTCCAGG + Intergenic
1053359340 9:37473011-37473033 TCACACAGCCTCTGCCTCCCAGG - Intergenic
1055361889 9:75500447-75500469 TCACACGGCCTTTGCATCTCTGG + Intergenic
1057205838 9:93171973-93171995 TCACTGCACCTCTGCCTCCCAGG + Intergenic
1057236901 9:93368292-93368314 CCACTTGGCCTCTGTCACCCTGG + Intergenic
1058720121 9:107756774-107756796 TCACTGCACCTCTGCCTCCCGGG + Intergenic
1059068337 9:111108516-111108538 TCCCTTTGCCTCTGCCTTCCGGG + Intergenic
1059096949 9:111427082-111427104 TCACTCAGCCTCTACCTCCCAGG - Intronic
1059170919 9:112123713-112123735 TCACTTGGTCACTGCAACCCAGG + Intronic
1059199721 9:112402867-112402889 TCACTCAACCTCTGCCTCCCGGG - Intronic
1059702665 9:116790748-116790770 TCACTGCACCTCTGCCTCCCAGG + Intronic
1059737232 9:117114345-117114367 TCACTTCTCCTCTGCATTTCAGG + Intronic
1059911066 9:119044716-119044738 TAATTTGGCCTCAGGATCCCTGG - Intergenic
1059925986 9:119209490-119209512 TCACTTGACCTCTGCCTCCCGGG - Intronic
1061761351 9:132854123-132854145 TCACTTAGCCTCAACTTCCCAGG - Intronic
1061804421 9:133130045-133130067 TCACTGCACCTCTGCCTCCCGGG + Intronic
1062409291 9:136414396-136414418 ACACTTGGGCTTTGCATGCCAGG - Intronic
1185847818 X:3456035-3456057 TCACTTGTCATCTGCATCTCTGG + Intergenic
1186191431 X:7070651-7070673 TCACTGCACCTCTGCCTCCCGGG + Intronic
1186521876 X:10213524-10213546 ACACTGGGCCTCTGGAACCCAGG - Intronic
1187704751 X:21998746-21998768 TTAGTTGGCCTGAGCATCCCAGG - Intergenic
1187809570 X:23160080-23160102 TCACTGCACCTCTGCCTCCCAGG - Intergenic
1187920306 X:24195266-24195288 TCACTGAACCTCTGCCTCCCAGG + Intronic
1188482262 X:30648142-30648164 TCACTGAACCTCTGCCTCCCAGG + Intergenic
1189163129 X:38831769-38831791 TCCCCTGGCCCCTGCTTCCCGGG + Intergenic
1189230139 X:39445693-39445715 TCAAGTGGGCTCTGCATACCAGG - Intergenic
1189372315 X:40438558-40438580 CCACTTGGCCCCTGCCACCCTGG - Intergenic
1189846945 X:45146915-45146937 TCATTTGACCTCCACATCCCAGG - Intergenic
1190139992 X:47834554-47834576 TCATTCTGCCCCTGCATCCCTGG - Intergenic
1190693573 X:52932684-52932706 TCACTGCACCTCTGCCTCCCAGG - Intronic
1191095965 X:56673235-56673257 CCACTTTGCTTCTGCCTCCCCGG + Intergenic
1191650033 X:63527077-63527099 CCTCTTGCCCTCTGCTTCCCTGG + Intergenic
1191742756 X:64453114-64453136 CCACTTGGCCCCTGCCACCCTGG + Intergenic
1193115579 X:77772233-77772255 TCACTGCACCTCTGCCTCCCGGG - Intronic
1193720670 X:84982857-84982879 TCACTGCACCTCTGCCTCCCGGG - Intergenic
1193983945 X:88217851-88217873 TCACTTGGCCTCTGCCACCCTGG - Intergenic
1194343083 X:92729287-92729309 CCACTTGGCCTCTGCCACCTCGG - Intergenic
1194919478 X:99747735-99747757 TCACTCAGCCTCTGCATGACAGG + Intergenic
1194937890 X:99972999-99973021 TCTCTATGCCTATGCATCCCTGG + Intergenic
1195387646 X:104328411-104328433 TCACTTAGCCTCCGCCTCCTGGG + Intergenic
1196072483 X:111541885-111541907 TCCCTTCACCTCTGCATCCTCGG + Intergenic
1196354069 X:114768284-114768306 TCACTTAGCATCTGCTTCACAGG + Intronic
1197476459 X:126930572-126930594 CCTCTTGGCCTTTGCTTCCCTGG + Intergenic
1197771310 X:130091350-130091372 TCACTGCACCTCTGCCTCCCGGG - Intronic
1197866795 X:131027681-131027703 TCCCTTGGCCTGTGGATCCGAGG + Intergenic
1199284733 X:146043338-146043360 TCTCCTGGCCTCAGCCTCCCAGG + Intergenic
1200651443 Y:5845953-5845975 CCACTTGGCCTCTGCCACCTCGG - Intergenic