ID: 1166108855

View in Genome Browser
Species Human (GRCh38)
Location 19:40610832-40610854
Sequence CCTTTCTGTTTCCCATCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166108855_1166108860 14 Left 1166108855 19:40610832-40610854 CCAAGTGATGGGAAACAGAAAGG 0: 1
1: 0
2: 0
3: 33
4: 279
Right 1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 8
3: 86
4: 945
1166108855_1166108858 10 Left 1166108855 19:40610832-40610854 CCAAGTGATGGGAAACAGAAAGG 0: 1
1: 0
2: 0
3: 33
4: 279
Right 1166108858 19:40610865-40610887 AAAGATGGAGAAGCAGAATGAGG 0: 1
1: 0
2: 11
3: 105
4: 1151
1166108855_1166108859 13 Left 1166108855 19:40610832-40610854 CCAAGTGATGGGAAACAGAAAGG 0: 1
1: 0
2: 0
3: 33
4: 279
Right 1166108859 19:40610868-40610890 GATGGAGAAGCAGAATGAGGAGG 0: 1
1: 0
2: 10
3: 212
4: 2269
1166108855_1166108861 18 Left 1166108855 19:40610832-40610854 CCAAGTGATGGGAAACAGAAAGG 0: 1
1: 0
2: 0
3: 33
4: 279
Right 1166108861 19:40610873-40610895 AGAAGCAGAATGAGGAGGGATGG 0: 1
1: 1
2: 16
3: 139
4: 1472
1166108855_1166108857 -5 Left 1166108855 19:40610832-40610854 CCAAGTGATGGGAAACAGAAAGG 0: 1
1: 0
2: 0
3: 33
4: 279
Right 1166108857 19:40610850-40610872 AAAGGCTGAGTCATGAAAGATGG 0: 1
1: 0
2: 2
3: 31
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166108855 Original CRISPR CCTTTCTGTTTCCCATCACT TGG (reversed) Intronic
900326315 1:2110271-2110293 CCGTTCTGTTTCTCACCTCTGGG - Intronic
900763219 1:4486766-4486788 CCTTTCTGTCTCCCCTCTCTGGG - Intergenic
900961396 1:5923364-5923386 CTCTTCTGTTTCCCAGCCCTTGG - Intronic
901823838 1:11847741-11847763 CCTCTCTGGTTCCCCTCTCTTGG + Exonic
902595958 1:17509635-17509657 CCTTTACGTTTCCCAGGACTCGG + Intergenic
903830103 1:26169600-26169622 CCTTCCTGTTTCCCAGACCTTGG - Intergenic
904776120 1:32907884-32907906 CCTTTACTTTTCCCATCAGTTGG + Intergenic
906013049 1:42547629-42547651 CCAATCTGCTTCCCATAACTGGG + Intronic
906072208 1:43025257-43025279 CCTGTCTGTTTCTCATCCTTTGG + Intergenic
906901768 1:49843680-49843702 CCTGTATGTTTCCCATTACATGG - Intronic
907507918 1:54935051-54935073 CATTTCTCTTTGCCTTCACTTGG - Intergenic
910191955 1:84604122-84604144 CCTTTCACTTTGCCATCACATGG + Intergenic
911135502 1:94435129-94435151 CCTTTGTATTTCCCATAAATTGG + Intronic
913216819 1:116627789-116627811 ACCTTCTGTCTCCCAACACTAGG + Intronic
913430867 1:118789213-118789235 CCATTCTCTTTCTCTTCACTGGG + Intergenic
913479214 1:119269697-119269719 CATTTCTGTTTTCCATCAAAGGG - Intergenic
913697987 1:121346470-121346492 CCTTTCAGTTTTTCATGACTGGG + Intronic
914139564 1:144933581-144933603 CCTTTCAGTTTTTCATGACTGGG - Intronic
914384399 1:147153886-147153908 CCTTTCTGTAACCCATTTCTTGG - Intergenic
914696686 1:150089110-150089132 CTTTTCTATTTACCTTCACTTGG - Intronic
915965926 1:160308049-160308071 CATCTCTGTTGCCCACCACTGGG + Intronic
918848824 1:189656490-189656512 CCTTTCTATTTAGCATCACATGG - Intergenic
918874444 1:190021380-190021402 CCTACCTGTTTACAATCACTAGG - Intergenic
919280466 1:195482890-195482912 CCTATTTTTTTCCCATCACCTGG + Intergenic
920485383 1:206365120-206365142 CCTTTCAGTTTTTCATGACTGGG + Intronic
920959416 1:210651432-210651454 CCCTTGTGTTTCCCAACCCTAGG - Intronic
921178560 1:212613964-212613986 CCTTTCTCATTCCCATTGCTTGG - Intronic
921178640 1:212614403-212614425 CCTTTCTCATTCCCATTGCTTGG + Intronic
921728394 1:218549690-218549712 CCTTTGAGTTGCTCATCACTGGG - Intergenic
924453968 1:244203324-244203346 CCTTTAAGTTTCTCATCACCCGG + Intergenic
1063183683 10:3631105-3631127 CCCTTCTGTTTCCCAGCAGTGGG - Intergenic
1065076510 10:22084925-22084947 CCTTTTCTTTTGCCATCACTTGG + Intergenic
1067680624 10:48435990-48436012 CTTTCCTGTTTCCTATTACTTGG + Exonic
1068962123 10:62877458-62877480 CCCTTCTGTTTCCCCTCTCCAGG - Intronic
1069091883 10:64209367-64209389 CCTTACTGTTTCCCAAAAATGGG + Intergenic
1069551879 10:69369715-69369737 CTTTTCTGTTTGTGATCACTTGG - Intronic
1070824555 10:79383442-79383464 CTTTTCTGTTTCCCGTTATTGGG - Exonic
1072010507 10:91299096-91299118 GCTTCCTGATTCCCATCCCTGGG - Intergenic
1072158757 10:92747243-92747265 CCTCCCTGTGTCCCAGCACTGGG - Intergenic
1072466720 10:95670112-95670134 CCTTTTTCCTTCCCATCACATGG + Intronic
1073875882 10:107920781-107920803 CATTCCTGTATCCCCTCACTGGG + Intergenic
1074542596 10:114377755-114377777 CCTCTGTGTTTCTCAGCACTTGG - Intronic
1074798991 10:116979711-116979733 CCTTTCTGATGCTCAGCACTTGG + Intronic
1075541594 10:123318546-123318568 GCGTTCTTATTCCCATCACTTGG - Intergenic
1076191157 10:128484284-128484306 CCTGTCTGTGTCCCACCTCTGGG - Intergenic
1076570816 10:131431885-131431907 CCTTTCTGTTCCCCTTGCCTAGG - Intergenic
1077678410 11:4217799-4217821 CTATTCTCTTTTCCATCACTAGG + Intergenic
1077847628 11:6042786-6042808 CTTTTTTGTTTCCTATCTCTTGG + Intergenic
1078331552 11:10426308-10426330 CCTCACGGTTTCCCTTCACTAGG + Intronic
1080018312 11:27531341-27531363 TCTTTCCATTTCCCCTCACTGGG + Intergenic
1080225933 11:29960136-29960158 CCTTGCTATTTCCCATAACTTGG + Intergenic
1080286997 11:30626576-30626598 CCTTTATGTTCCCCAACACTTGG + Intergenic
1081543544 11:44053251-44053273 CCTTCCTGTTTCCCCTCTTTGGG + Intronic
1082950086 11:58805404-58805426 CCTCTCAGTTTTCCATCATTTGG + Intergenic
1083067527 11:59940508-59940530 CTTTTTTGTTGTCCATCACTTGG + Intergenic
1084054149 11:66620917-66620939 CCTTTCTGCTTGCCATCTCCAGG + Intronic
1086493397 11:87377927-87377949 CCTTTCTGGTTACCCTCAGTTGG + Intergenic
1089062746 11:115639445-115639467 CACTTCTGTTTACCTTCACTGGG - Intergenic
1089200857 11:116724027-116724049 CCTTTCTTTTCACCATCCCTGGG + Intergenic
1089235629 11:117022379-117022401 CCTTTGTGTTTCCCAACTCAGGG - Intronic
1090314990 11:125778346-125778368 ACTTTCTTTTACCCATTACTCGG - Intronic
1091920810 12:4303200-4303222 CTTTTCTCTTTCCCATCCTTGGG + Exonic
1092788106 12:12047633-12047655 CCTTTCATTTCCCCCTCACTTGG - Intergenic
1092916048 12:13189957-13189979 CTATTCTGTTTCCCATCCATTGG - Intergenic
1093005862 12:14050045-14050067 ACTTTCTGTTTCCCACCATCAGG - Intergenic
1093366981 12:18314504-18314526 TCTTTCTCTTTCCTCTCACTAGG + Intronic
1094653977 12:32403295-32403317 CCTTTCTGTTTCACTTAAATGGG - Intronic
1095378807 12:41564388-41564410 CCTTTTTATCTCCCATCACAAGG + Intronic
1096851176 12:54438595-54438617 ACTATCTGTTTCCCACCACTGGG - Intergenic
1098337216 12:69416466-69416488 CCATTCTGATAACCATCACTAGG - Intergenic
1100093732 12:91005941-91005963 CCTTCTTCTCTCCCATCACTTGG - Intergenic
1101285197 12:103304750-103304772 ATCTTCTGTTTCCCATCACCAGG + Intronic
1101469817 12:104986161-104986183 CCTTTCTTTTTCCCAGGAGTAGG + Intergenic
1102497761 12:113331139-113331161 CCTCTCTTTCTCCCACCACTGGG + Intronic
1102921320 12:116793707-116793729 GCTGTCTCCTTCCCATCACTTGG + Intronic
1104099499 12:125593092-125593114 CCTTTCCTTTGCCCATCACTGGG + Intronic
1104491632 12:129199518-129199540 CATTTCTGGTTCCCATCTGTAGG - Intronic
1104619433 12:130299823-130299845 TCCTGCTGTTTCCCATCACCCGG + Intergenic
1106598097 13:31163746-31163768 CCTTTCTGTATTCCATCTCATGG + Intergenic
1106947135 13:34841400-34841422 CCTTTCCTTTTCCCCTCACAGGG - Intergenic
1108820592 13:54345144-54345166 CCTTTCTATTTTCCATTTCTTGG + Intergenic
1110257007 13:73443983-73444005 CCTATTTTTTCCCCATCACTTGG - Intergenic
1110269854 13:73577026-73577048 CATTACTGCTTCCCATGACTTGG + Intergenic
1110709212 13:78631564-78631586 CCCTTCAGTTTCCCCTAACTTGG - Intronic
1113196960 13:107819025-107819047 TCTTTCTGTTTCCCATAAAGTGG + Intronic
1114944035 14:27655890-27655912 CCTTTTTTTTTCCCATTACATGG + Intergenic
1115467943 14:33736709-33736731 CCTTTCTGTTTTCTGTCTCTCGG + Intronic
1115769843 14:36657509-36657531 CCTGCCTGTTTCCGATCACCCGG - Intergenic
1118941521 14:70344039-70344061 CCTTGCTGTTTTCTGTCACTGGG + Intronic
1122848640 14:104514563-104514585 TCTGTCTGTTTCCCATGACTGGG - Intronic
1124052657 15:26212491-26212513 CCTTTATGTTTCTCTTCACTTGG - Intergenic
1124375763 15:29127765-29127787 CCTTCCTGTTTCCCATCTCAGGG - Intronic
1126138737 15:45418780-45418802 TCTGTCTGTTTCACATCACATGG - Intronic
1126351812 15:47751901-47751923 CCTTTCTGCCTCCCATCCTTGGG - Intronic
1126441572 15:48695194-48695216 CCTTTCAGATTGCAATCACTTGG - Intergenic
1126528680 15:49687957-49687979 CCTTTGTGTCTCTCATCACAGGG - Intergenic
1126713344 15:51485209-51485231 CCTATCTCTTTCCCAAGACTTGG - Intronic
1127346941 15:58110432-58110454 CTTTTCCGCTTCCCATCAATTGG - Intronic
1127412044 15:58718977-58718999 CCTTACTGTTTCCCCTCTCAGGG + Intronic
1128910651 15:71511142-71511164 TCTCTCTGTTTCCCATTATTTGG - Intronic
1129772487 15:78211698-78211720 CCTTTCTCTTAACCATCTCTTGG + Intronic
1129821395 15:78604420-78604442 CATTTCTGTGTCTCCTCACTTGG - Intronic
1130803930 15:87298427-87298449 CCTTTCTCTGTCACTTCACTGGG + Intergenic
1130856421 15:87843449-87843471 ACCACCTGTTTCCCATCACTGGG + Intergenic
1130911224 15:88272091-88272113 CCTTTCTGTGGACCATCTCTCGG - Intergenic
1131102939 15:89708091-89708113 CAGATCTGTTTTCCATCACTAGG - Intronic
1133528502 16:6630280-6630302 CCTTTCTCTTTTCCATTCCTTGG - Intronic
1133708612 16:8379509-8379531 CCTGTATGATTCCCATCAGTGGG - Intergenic
1135008418 16:18849752-18849774 CCTTTCAGCTTCCCATTTCTTGG + Intronic
1135304104 16:21354326-21354348 TCTTTTTTTTTCCCATCATTTGG + Intergenic
1135655212 16:24242505-24242527 CCTTTTTGCTACCCATCACAAGG - Intergenic
1139229712 16:65272086-65272108 CATTTCTGTTTCCCATTAGCAGG - Intergenic
1139819642 16:69711020-69711042 CCTTTCTGTGGGCCATCACTTGG - Exonic
1140566096 16:76044162-76044184 ACTTTCAGTTCCACATCACTGGG - Intergenic
1140726150 16:77814463-77814485 GCTCTCAGTTTACCATCACTGGG + Intronic
1140997852 16:80278516-80278538 CCTATATTTTTCCCATCATTTGG + Intergenic
1141851338 16:86648182-86648204 CCATTGAGCTTCCCATCACTGGG + Intergenic
1143282240 17:5763561-5763583 CCTATGTGTTTCTCATCTCTTGG - Intergenic
1143520426 17:7441261-7441283 CCCTTCTGTTTCCTATAACCAGG - Intronic
1144650949 17:17006448-17006470 CCCTTCTCTCTCCCATCCCTAGG - Intergenic
1147371094 17:39993551-39993573 CCATCCTCCTTCCCATCACTTGG + Intronic
1148575230 17:48705928-48705950 CCCTTCTGTTACCCACCACCTGG - Intergenic
1148682147 17:49480452-49480474 CCCCTCTGCTTCCCAGCACTAGG - Intergenic
1149666667 17:58369638-58369660 CCTGTCTGTTTCTCAAAACTAGG - Intronic
1150129658 17:62661093-62661115 CCTGGCTGTTTCCTATCTCTGGG - Intronic
1150293920 17:63998121-63998143 CCTTGCTGGTTCCCAGAACTGGG - Intergenic
1151677396 17:75605720-75605742 CCCTTCTGTCTCCCACCACTTGG - Intergenic
1152222359 17:79075562-79075584 CCTTTCTGTTCCCCGCCAGTTGG - Intronic
1155033576 18:22004935-22004957 CCTTCCTGTTGCCCATCTTTTGG - Intergenic
1155633883 18:27927617-27927639 CCTTTCTGTCTCTCCTCTCTAGG + Intergenic
1156918734 18:42492912-42492934 TTTTTCTGTTTTCCTTCACTGGG + Intergenic
1157441916 18:47718143-47718165 CCTCTTTGTCTCCCACCACTTGG - Intergenic
1157826576 18:50817723-50817745 TCTTTCTCTTTCTCATCCCTCGG - Intronic
1157899312 18:51498800-51498822 CCTTTGTGTTTGGCATCGCTAGG - Intergenic
1158404896 18:57152244-57152266 TCTTTCTGTTCCCCATCCCTCGG + Intergenic
1158483433 18:57843370-57843392 CCTGTCTTTTTCCTCTCACTGGG + Intergenic
1159135318 18:64330495-64330517 CCTTGCTGTGTCCCCTCCCTGGG + Intergenic
1160586607 18:79916737-79916759 CCTCTGTGTATCCCCTCACTCGG + Intronic
1161139793 19:2640452-2640474 CATTCCTCATTCCCATCACTGGG - Intronic
1161614860 19:5264427-5264449 CCTGTCTGTCTCCCATTGCTTGG + Intronic
1161726113 19:5930007-5930029 CCTTGCTGTGTCCCATCCCAGGG - Intronic
1165656189 19:37534239-37534261 ATTTTCTGTTTTCCATAACTTGG + Intronic
1166108855 19:40610832-40610854 CCTTTCTGTTTCCCATCACTTGG - Intronic
1167889312 19:52527287-52527309 CCTTTCTATCTCCATTCACTAGG - Intergenic
925131187 2:1495265-1495287 CTCTTCTGCTTCCCATCACAGGG - Intronic
925955652 2:8961567-8961589 CATTTCCATTTCCCATCAGTAGG + Intronic
927361907 2:22245864-22245886 CCTTCCTGTTCCTCATCACAGGG + Intergenic
927602132 2:24452693-24452715 CTTTTCAGTTTGCCATCCCTAGG - Intergenic
927961687 2:27244245-27244267 CCCTCCTATTTCCCATCCCTGGG + Intergenic
928986048 2:37182721-37182743 CCTTTCTGTTTCCTCTCTCCTGG - Intronic
930806020 2:55491620-55491642 CCTTTCTCCTTCCCACAACTTGG - Intergenic
931044849 2:58340476-58340498 TCTTACTGTTTCCCCACACTGGG - Intergenic
931112098 2:59122295-59122317 CATTTCTGTTTGTCAGCACTAGG - Intergenic
931926221 2:67075334-67075356 CCTTTCAGTTTAACATCATTCGG - Intergenic
934514539 2:94977897-94977919 CCTTGCTGTTTCCCAGCCCGAGG - Intergenic
934699064 2:96423937-96423959 CATTTCTCTTTCCCAGCCCTTGG + Intergenic
936461186 2:112714697-112714719 TCTTTCTGCCTCCCAGCACTGGG + Intergenic
937078042 2:119121310-119121332 CCTTTCTGTGGCCCACCTCTGGG + Intergenic
937315872 2:120931857-120931879 CCATGCTGCTGCCCATCACTGGG - Intronic
940807796 2:158207462-158207484 AATTTCTGTTTCCCATCCCCAGG + Intronic
941399138 2:165008914-165008936 CCTTTTTGCTTTCCACCACTAGG + Intergenic
946448161 2:219757497-219757519 TCTTTCTGCATCCCAGCACTAGG - Intergenic
946582231 2:221142129-221142151 CCCTTCTGCTTCCTATCACAGGG + Intergenic
949045172 2:241869602-241869624 CCTTTCTGCTTCCCATTTCTCGG + Intronic
1169115276 20:3060417-3060439 GCTTTCAGTTTCCAATCATTTGG + Intergenic
1169528041 20:6451965-6451987 ACATTATGTTGCCCATCACTTGG + Intergenic
1169626474 20:7576514-7576536 TGTTTGTGTTTTCCATCACTTGG - Intergenic
1169742230 20:8907517-8907539 CCATTCCTTTTGCCATCACTTGG + Intronic
1171118464 20:22547781-22547803 CTTATTTGTCTCCCATCACTAGG - Intergenic
1171358061 20:24565865-24565887 TCTTTCTCTTGCCCTTCACTTGG + Intronic
1175057902 20:56214786-56214808 CCATTCTCCTTCCCATCACCAGG + Intergenic
1175214022 20:57380695-57380717 CCTTGCTGTTTACCTTCTCTTGG - Intergenic
1175296522 20:57912560-57912582 CTTTTCTGTTGCCCTTCACTTGG - Intergenic
1178136919 21:29637935-29637957 ACTTTCGGTTTTCCACCACTAGG + Intronic
1178343852 21:31808371-31808393 CCCTCCTGTCCCCCATCACTGGG - Intergenic
1180818175 22:18806171-18806193 ACCTTCTGTCTCCCAACACTAGG + Intergenic
1181204395 22:21240626-21240648 ACCTTCTGTCTCCCAACACTAGG + Intergenic
1182064186 22:27418728-27418750 CCTGTCTGAATCCCAGCACTGGG - Intergenic
1182787391 22:32919108-32919130 CCTTTCTCCTTCCCCTCATTTGG + Intronic
1182888059 22:33792872-33792894 CCTTTCTTTTTCCCGTGGCTGGG - Intronic
1183122995 22:35745709-35745731 CCTTTCTGCTGCCCTTAACTAGG + Intronic
1184946184 22:47805685-47805707 CCTTCCTTCATCCCATCACTGGG - Intergenic
1203222527 22_KI270731v1_random:54789-54811 ACCTTCTGTCTCCCAACACTAGG - Intergenic
1203268302 22_KI270734v1_random:32025-32047 ACCTTCTGTCTCCCAACACTAGG + Intergenic
949652445 3:6175806-6175828 CCATTCAGTATCCCATTACTGGG - Intergenic
950714651 3:14839129-14839151 CCTGTCTGTTTCTCAACACTAGG + Intronic
951502568 3:23405941-23405963 CCATTGAGTTTCCCATAACTAGG + Intronic
951737838 3:25887440-25887462 CTTTTCTGTATTACATCACTGGG + Intergenic
952875561 3:37941649-37941671 CATTCCTGTATCCCAGCACTTGG - Intronic
953159843 3:40408389-40408411 GCTTTCTTTTTTCCATCTCTAGG - Intronic
953501661 3:43442048-43442070 GCTTTCAGTTTTCCATCATTTGG - Intronic
957307829 3:78480972-78480994 CCTTCCTGTCACCCATAACTTGG - Intergenic
958632612 3:96701922-96701944 CCCTTCTGTTTGCCATCTCAGGG + Intergenic
959215958 3:103450031-103450053 CCTCTCTGGCTACCATCACTGGG - Intergenic
959308343 3:104697214-104697236 CCATTCACTTTCCCGTCACTGGG + Intergenic
961703687 3:128767016-128767038 TCTTTCTTTTGACCATCACTGGG + Intronic
962324404 3:134421607-134421629 CCTTTCTGGTATCCATCTCTGGG + Intergenic
963305927 3:143652910-143652932 CCTTTCTGGATCCCAGCATTTGG + Intronic
966428496 3:179807070-179807092 TCTTTCTTTTTCCCATTACCAGG - Intronic
967080807 3:186047964-186047986 CCTTTCTCTTCCCAATCACGTGG - Exonic
967224178 3:187275162-187275184 CCTTTGTGTTTCCCATCCTCAGG - Intronic
967954040 3:194863418-194863440 CCTTTTTGAGTCCCCTCACTGGG + Intergenic
969052281 4:4381613-4381635 CCTTTGTGTTTCCCAGCGCTTGG - Intronic
970804739 4:20017645-20017667 CCTTTCTCTGTCTCATCATTTGG + Intergenic
971042156 4:22765660-22765682 CCTTTCTGTCTTCCTTCACTTGG + Intergenic
971343230 4:25789652-25789674 TCTTTCCCTTTCCCATCTCTGGG + Intronic
974645823 4:64690678-64690700 TCTTTCCATTTACCATCACTAGG + Intergenic
974756269 4:66211689-66211711 CCAATTTGTTTCCAATCACTTGG + Intergenic
975482101 4:74891943-74891965 TCTTTCTGCTCCCCATCAATGGG + Intergenic
976416051 4:84776585-84776607 CCCTTCTGTCTACCATCTCTGGG + Intronic
977165725 4:93694357-93694379 CCTTACTGTTTCCATTCAGTAGG + Intronic
978302136 4:107282313-107282335 CATTTTTGATTCCCATGACTAGG + Intronic
978347803 4:107789341-107789363 CCATTCTCTTTCCCATCTCTGGG - Intergenic
978441981 4:108743207-108743229 CCTTTCTGTTTCCCAGCCCAGGG + Intronic
978946899 4:114510453-114510475 CCTTTCTGCTTCTCTTCACAGGG + Intergenic
980661775 4:135869808-135869830 CCTTTATGTTGGCAATCACTGGG - Intergenic
982169101 4:152643968-152643990 CCTCTCTCTCTCCCATCCCTGGG + Intronic
983934934 4:173495096-173495118 CCTTTGATTTTCCAATCACTTGG - Intergenic
984507068 4:180633299-180633321 GCTTTCTCTGTCCCATAACTAGG + Intergenic
984718375 4:182947350-182947372 CCTAACTTTTTCCCCTCACTCGG - Intergenic
985063027 4:186096900-186096922 GCCTTCTGTTTCTCATCACTGGG - Intergenic
986224099 5:5797086-5797108 CTATTCTGTTTACCACCACTTGG + Intergenic
987122226 5:14778110-14778132 CCTTCCTGTTGCCCAGCTCTGGG - Intronic
987138346 5:14920513-14920535 CATCTTTCTTTCCCATCACTAGG - Intergenic
988164330 5:27564235-27564257 CCATTCTCTTTGCCATCACATGG + Intergenic
988234678 5:28526546-28526568 TATTTTTGTTTCCCTTCACTAGG + Intergenic
989262834 5:39437637-39437659 CCTGTCTGTTTCACACCACGGGG + Intronic
989655026 5:43737257-43737279 CCTTACTCTTTCCCTGCACTAGG + Intergenic
989964489 5:50451860-50451882 TCTGAGTGTTTCCCATCACTTGG + Intergenic
991603159 5:68373511-68373533 ACTTTTTGTTTCCTTTCACTTGG - Intergenic
994212956 5:97106479-97106501 CTTCTCTGTTTCCCTTAACTAGG - Intronic
996461159 5:123744612-123744634 CCTTGCTGTTTCCCATAAGTTGG + Intergenic
1001010512 5:168093512-168093534 TCCTTCTGTTTCACATCACGGGG - Intronic
1001153988 5:169257281-169257303 TCTTTCAGTTTCCCATCCCTGGG - Intronic
1001432172 5:171670960-171670982 CTTTTCTTTTTCCCTTCACTGGG + Intergenic
1005863351 6:29918054-29918076 CCTTCCTTCTTTCCATCACTGGG + Intergenic
1006087075 6:31603665-31603687 GCTTTGTGTTTCCATTCACTGGG - Intergenic
1006347791 6:33497538-33497560 CATTTCTTTTCCCCAACACTTGG + Intergenic
1007068369 6:39016006-39016028 ACTTTCTGTTCCACCTCACTTGG + Intronic
1009868322 6:69425542-69425564 CCTTTCTTTTTCACATCATCTGG + Intergenic
1010881830 6:81185316-81185338 CCTTTATGCTTCACATCACTGGG - Intergenic
1013347573 6:109276964-109276986 CCTTTCTGTCTCCCATGCCTGGG - Intergenic
1014037653 6:116786072-116786094 CTTTTCTGTTTACCATCATAGGG + Intergenic
1014584538 6:123182369-123182391 CCTTACTGCTTCCCTTGACTGGG - Intergenic
1015341675 6:132108078-132108100 CCTTTCTCTGTCTCATCACTTGG + Intergenic
1015346989 6:132171684-132171706 CCTTTCTTTTGCCCAGCATTTGG + Intergenic
1015469015 6:133581705-133581727 CCTTTCAGTTTTTCATCACTGGG - Intergenic
1016472316 6:144387754-144387776 CATTTCTGTCTCCCATCCTTTGG + Intronic
1018133286 6:160752785-160752807 CCTTTCTGATTTCAATTACTGGG + Intronic
1022610980 7:31872878-31872900 CTTTTTTTTTTCCCACCACTTGG - Intronic
1023477113 7:40592823-40592845 CATTGCTGTTTCCCATCTCTAGG + Intronic
1023523703 7:41075646-41075668 ACTGTCTGTCTCCCCTCACTAGG - Intergenic
1023733766 7:43217090-43217112 CCTGTTTGTGTCCCATCCCTAGG + Intronic
1023965253 7:44960795-44960817 CCTTCCTCTTTTCCATCAGTTGG - Intergenic
1024264847 7:47598672-47598694 CCTTCCTGTTTGCCATCTCAAGG + Intergenic
1024398722 7:48898950-48898972 CCTTACTGTGTCCCCTCCCTGGG + Intergenic
1026086543 7:67267682-67267704 GATTTGTGTTTCCCATGACTGGG - Intergenic
1026206300 7:68260716-68260738 CCTTCTTCTTTCCCTTCACTTGG + Intergenic
1026667864 7:72359265-72359287 CATTTCTGAGTCCCATCACACGG + Intronic
1026690595 7:72547176-72547198 GATTTGTGTTTCCCATGACTGGG + Intergenic
1026904959 7:74057573-74057595 CCTCCCTGCTTCCCATCTCTAGG - Intronic
1029270376 7:99374077-99374099 CCTTTCTGTTTTACGTCAATCGG - Intronic
1029592069 7:101513961-101513983 CATTTCTGTTTCCCCACTCTGGG - Intronic
1030248362 7:107411064-107411086 CTTTTGTGTCTCCCATCTCTAGG - Intronic
1035415047 7:158676205-158676227 CCTTTGTGTTTCCTATAAATTGG - Intronic
1036408633 8:8478365-8478387 CCCTTCTGTTCCCCTTGACTGGG - Intergenic
1036784623 8:11677643-11677665 CTGTGCTGTTTCCCATCGCTTGG + Intronic
1038827821 8:31024594-31024616 CTTTTCTGTTTGCCACCTCTAGG + Intronic
1039149044 8:34482647-34482669 CCTTTGTGTCTCCCATGACTTGG + Intergenic
1042521379 8:69715186-69715208 ACCTTCAGTTTCCCAGCACTAGG - Intronic
1043679804 8:83009380-83009402 CCTTTCAGAGTCCCTTCACTGGG - Intergenic
1046796807 8:118382226-118382248 CCTTTCTGTTCCCAATTATTTGG + Intronic
1047858724 8:128940963-128940985 CATTTCTGGTTCCAATCATTTGG + Intergenic
1049679164 8:143909525-143909547 CTTTCCTGTTTCCCATCTCTGGG + Intergenic
1050078834 9:1893532-1893554 CATTGCTGTTTCCCATCCCTCGG - Intergenic
1051541090 9:18218476-18218498 ACTTTTTGTTTCACATCATTTGG - Intergenic
1052016957 9:23479884-23479906 CCTCTAAGTGTCCCATCACTTGG - Intergenic
1052084379 9:24246771-24246793 ATTTTCTGTCTCCCCTCACTGGG - Intergenic
1052797481 9:32936719-32936741 ACTTTTTGTTTCCTCTCACTAGG - Intergenic
1053671473 9:40368370-40368392 CATTTCTTGTTCCCATCACATGG - Intergenic
1053921281 9:42994744-42994766 CATTTCTTGTTCCCATCACATGG - Intergenic
1054382583 9:64508420-64508442 CATTTCTTGTTCCCATCACATGG - Intergenic
1054513144 9:66007940-66007962 CATTTCTTGTTCCCATCACATGG + Intergenic
1055179339 9:73364527-73364549 CCTTCCTGTTCCCCATGATTTGG + Intergenic
1055375721 9:75646984-75647006 CCTTCCTGTTTGCCATCTCAGGG - Intergenic
1056114536 9:83429295-83429317 CCTTTCAGGTTCCTGTCACTTGG + Intronic
1057757421 9:97849085-97849107 CCTTTCGGTTTCCCAGAGCTCGG - Intergenic
1057903585 9:98967530-98967552 CATTCCTGTTTTCCATCAGTGGG + Intronic
1058058114 9:100469517-100469539 CCTTTTTGTTTACCTTAACTTGG + Intronic
1058903025 9:109458342-109458364 CCATGCTGTTTGCCATCCCTGGG - Intronic
1060798244 9:126526962-126526984 CGTTTCTCTTACCCATGACTGGG - Intergenic
1061081747 9:128374916-128374938 CATTTCTGTGTCCCAGCACCTGG - Intronic
1185489275 X:508408-508430 CCTTTCTGTTCACCACCACGTGG - Intergenic
1186248206 X:7637373-7637395 CCTTTCTGTTTCCTAAGCCTAGG - Intergenic
1187018585 X:15355840-15355862 CTTCTATGTTTCCCATCGCTTGG - Intronic
1187610099 X:20933345-20933367 CCTTCCTTTTTTCCTTCACTTGG - Intergenic
1187781048 X:22825300-22825322 CCTTACATTTTCCCATCAATTGG + Intergenic
1188568831 X:31557719-31557741 CCTTTCTCTTTCCCCTCCTTTGG - Intronic
1188676649 X:32949672-32949694 CCATTGTGTTTCCCATCCCAAGG - Intronic
1188706509 X:33339387-33339409 ACTTTCTGGTTCCCAGCAGTCGG - Intronic
1190283527 X:48947074-48947096 TCTTTCTGTTTCACAACACCTGG - Intronic
1190888582 X:54550463-54550485 TCTTTGTGTTTCCCCTCACTGGG - Intronic
1192143616 X:68665661-68665683 CCTCTCTGTCTCCCTCCACTGGG + Intronic
1192656600 X:73000706-73000728 CATTTCTGTTTCCTAACAATGGG + Intergenic
1192665520 X:73082295-73082317 CATTTCTGTTTCCTAACAATGGG - Intergenic
1193610676 X:83628370-83628392 CTTTTCTGTTTTCCATTGCTTGG + Intergenic
1193803220 X:85962547-85962569 CCTCTCTGTCCCCTATCACTTGG + Intronic
1193838901 X:86384071-86384093 CCCTTCATTTTCACATCACTAGG - Intronic
1194635652 X:96342697-96342719 CCTTCCTGTTCCTCCTCACTGGG - Intergenic
1195259865 X:103121609-103121631 CTGTTCTGTTTCCCATCAGTGGG + Intergenic
1196245689 X:113396594-113396616 CTTTTCTATTACCCATCACGAGG - Intergenic
1197050786 X:122056849-122056871 ACTCACTGTTTCCCATTACTTGG + Intergenic
1200273506 X:154710456-154710478 CCTTTCTGCTTTCTATCCCTTGG - Intronic