ID: 1166108860

View in Genome Browser
Species Human (GRCh38)
Location 19:40610869-40610891
Sequence ATGGAGAAGCAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1041
Summary {0: 1, 1: 1, 2: 8, 3: 86, 4: 945}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166108855_1166108860 14 Left 1166108855 19:40610832-40610854 CCAAGTGATGGGAAACAGAAAGG 0: 1
1: 0
2: 0
3: 33
4: 279
Right 1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 8
3: 86
4: 945
1166108852_1166108860 29 Left 1166108852 19:40610817-40610839 CCTGGGATGCAGAGGCCAAGTGA 0: 1
1: 0
2: 6
3: 51
4: 469
Right 1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 8
3: 86
4: 945

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166108860 Original CRISPR ATGGAGAAGCAGAATGAGGA GGG Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG + Intergenic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918832934 1:189422076-189422098 ATAGGCAAGCAGAATGAAGAAGG - Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921977885 1:221222221-221222243 GTGGGGAAGCAGAATGTGTAGGG + Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1064818764 10:19299268-19299290 ATGGAGAAGCAGAATTCCCAAGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG + Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092205779 12:6613623-6613645 ATGGTGGTGCAGAATGGGGAGGG - Intergenic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110554291 13:76840858-76840880 ATGTAGAAGCAAAATGAGTGTGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG + Intergenic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127126661 15:55818920-55818942 AGGGAGAAGCACAATGAAAATGG - Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141908304 16:87041853-87041875 AAGGAGAAGTGGAATTAGGAGGG - Intergenic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1182033230 22:27176511-27176533 AGCGTGAAGTAGAATGAGGACGG - Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949329094 3:2901480-2901502 ATGGAGAAGGTGCATGAGGCAGG - Intronic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955796071 3:62638509-62638531 ATAGAGAAGCTGAATCAGAAAGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963465182 3:145670438-145670460 ATAGAGAAGCAGAACCAGTAGGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
974519100 4:62957865-62957887 ATGGAGAAGCAGATTGCAAATGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003803544 6:9699785-9699807 ATGGAGTAGCAGAAAGACCACGG - Intronic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033502238 7:141963535-141963557 ATAGAGATGCACAATGATGATGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG + Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1059754869 9:117283173-117283195 ATAGCGAAGTAGAATGAGCATGG - Intronic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193156513 X:78180072-78180094 ATGGAGAACCAGAATATGTAGGG - Intergenic
1193492307 X:82165186-82165208 ATATAGAAGCAAAATGAGGGAGG + Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194940482 X:100003598-100003620 AGGGAGGACCATAATGAGGATGG - Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic