ID: 1166109701

View in Genome Browser
Species Human (GRCh38)
Location 19:40614452-40614474
Sequence TAGCGAAGGCGGGTGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 265}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166109701_1166109715 22 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109715 19:40614497-40614519 GGCTGCTCCCTTGGGGACTGAGG 0: 1
1: 0
2: 1
3: 27
4: 320
1166109701_1166109709 -8 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109709 19:40614467-40614489 CTTCGCTAGCGCTTGCAACGCGG 0: 1
1: 0
2: 0
3: 0
4: 8
1166109701_1166109713 14 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109713 19:40614489-40614511 GTGCTGGAGGCTGCTCCCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 246
1166109701_1166109716 25 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109716 19:40614500-40614522 TGCTCCCTTGGGGACTGAGGAGG 0: 1
1: 0
2: 4
3: 43
4: 661
1166109701_1166109711 1 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109711 19:40614476-40614498 CGCTTGCAACGCGGTGCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1166109701_1166109714 15 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109714 19:40614490-40614512 TGCTGGAGGCTGCTCCCTTGGGG 0: 1
1: 0
2: 1
3: 26
4: 243
1166109701_1166109710 -2 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109710 19:40614473-40614495 TAGCGCTTGCAACGCGGTGCTGG 0: 1
1: 0
2: 0
3: 0
4: 16
1166109701_1166109717 26 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109717 19:40614501-40614523 GCTCCCTTGGGGACTGAGGAGGG 0: 1
1: 0
2: 4
3: 83
4: 1321
1166109701_1166109712 13 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109712 19:40614488-40614510 GGTGCTGGAGGCTGCTCCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 324
1166109701_1166109718 27 Left 1166109701 19:40614452-40614474 CCTGCCCCCACCCGCCTTCGCTA 0: 1
1: 1
2: 3
3: 14
4: 265
Right 1166109718 19:40614502-40614524 CTCCCTTGGGGACTGAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166109701 Original CRISPR TAGCGAAGGCGGGTGGGGGC AGG (reversed) Intronic
900117083 1:1033504-1033526 GAGCGGAGGCGGGTGCGGCCGGG - Intronic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900306377 1:2010874-2010896 CAGCCAAGGAGGGTGGGGACAGG - Intergenic
900378684 1:2373134-2373156 CAGGGATGGCAGGTGGGGGCAGG - Intronic
900530514 1:3150851-3150873 TATGGAGGCCGGGTGGGGGCGGG + Intronic
900562828 1:3316135-3316157 GACTGAGGGCGGGTGGGGGCGGG + Intronic
901696545 1:11012297-11012319 CAGCGAGGGCGGGGCGGGGCGGG - Intergenic
903275049 1:22216267-22216289 TAGACCAGGCGGGTGGAGGCGGG + Intergenic
903291406 1:22316488-22316510 TACAGAAGGCTGGTGGTGGCGGG - Intergenic
903369228 1:22824567-22824589 GAGGGAAGACGGGTGGAGGCTGG + Intronic
906640712 1:47439002-47439024 AAGCGAAGGCGTGCGGGTGCGGG - Exonic
908455185 1:64296672-64296694 TAGCGTATGGGGGTGGAGGCAGG - Intergenic
908523569 1:64966701-64966723 GAGCGAAGCCGGATGGGGGCGGG - Intergenic
909132433 1:71754630-71754652 TAGGGAATGCAGGTGGGGGTGGG - Intronic
910509894 1:87991918-87991940 TTGCCAAGGAGGGTGGGGTCTGG - Intergenic
911428755 1:97756336-97756358 TAGCGCAGGGTGGTGGGAGCAGG + Intronic
914196070 1:145448730-145448752 TAGGGAAGGAGAGTGGGAGCCGG - Intergenic
914673323 1:149888516-149888538 GAGTGCAGGCGGGTGGGGGTGGG - Intronic
915090483 1:153420807-153420829 TAGAGAAGGCAGCAGGGGGCTGG - Exonic
916208502 1:162338681-162338703 TAGCTAAGCAGGGTGGGGTCTGG + Intronic
917806450 1:178618152-178618174 GAGCAGAGGTGGGTGGGGGCTGG + Intergenic
919857472 1:201715547-201715569 TAGAGAATGAGGCTGGGGGCAGG + Intronic
920214358 1:204351352-204351374 TAGAGAAGGTGGGAGGGGTCGGG - Intronic
922634354 1:227151083-227151105 TAGAGAAGGATGGTGGGGACTGG - Intronic
922648682 1:227318380-227318402 GAGGGAAGGCGGGGGAGGGCTGG - Exonic
922819188 1:228472138-228472160 TGGTGAAGTGGGGTGGGGGCTGG - Intergenic
924091686 1:240507778-240507800 CAGAGAAGGAGGGTGGGGGTGGG + Intronic
1065571203 10:27072467-27072489 GGGCAAAGCCGGGTGGGGGCTGG - Intronic
1066296358 10:34057216-34057238 TAGCACAGGCGGGTGGGGACAGG - Intergenic
1067407258 10:46034295-46034317 TAGAGATGGCGGGTCGGCGCGGG + Intronic
1069595517 10:69667482-69667504 TTGTGAAGGCGGGTGGGAGAAGG - Intergenic
1073285109 10:102382785-102382807 GAGGGTAGGCAGGTGGGGGCTGG + Exonic
1073875279 10:107914988-107915010 TAGCGAAGTCGGGCCGCGGCGGG + Intergenic
1074302509 10:112245345-112245367 TCAGGAAGGCGGGTGGGGGAAGG + Intergenic
1074329934 10:112496189-112496211 TAGAGACGGCGGGGGGGGGGGGG - Intronic
1074755857 10:116623738-116623760 TGGGAAGGGCGGGTGGGGGCAGG - Intronic
1074858572 10:117491883-117491905 TAGTCAAGGCAGGTGTGGGCAGG - Intergenic
1076314620 10:129531766-129531788 TAGCGGGGGCTGGTGGGGGTGGG + Intronic
1076845569 10:133067997-133068019 GAGTGAAGGCGGCTGGGGGTGGG - Intergenic
1077233457 11:1468849-1468871 TAGCTAAGGGGGATGGGGGGGGG + Intergenic
1077459177 11:2700257-2700279 CAGGGACGACGGGTGGGGGCAGG - Intronic
1077635950 11:3841247-3841269 CCGCGGAGGCTGGTGGGGGCGGG - Intergenic
1078316086 11:10294252-10294274 GAGCCAGCGCGGGTGGGGGCGGG - Intergenic
1078531614 11:12140870-12140892 TAGAGAAGGTTGGTGGGGGAAGG - Intronic
1078771794 11:14358710-14358732 GAGCGGCGGCGGGCGGGGGCTGG - Intronic
1080836258 11:35943951-35943973 TAGCGGAGCCGGGCCGGGGCCGG + Intergenic
1083142593 11:60734069-60734091 TAGAGATGGCGGGTGGGGGGAGG - Intronic
1083229881 11:61310097-61310119 TAGCTTAGGCTGGTGGGGGATGG - Intronic
1083674681 11:64318843-64318865 AAGCCGAGGCGGGGGGGGGCGGG - Intronic
1084587346 11:70070259-70070281 TAGCCAAGGAGGGTGAGGGGAGG + Intergenic
1084691019 11:70726618-70726640 TTGGGAAGGCAGGTGGGGGTTGG + Intronic
1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG + Intronic
1089335208 11:117718223-117718245 TCGGGAAGGGGGGTGGGGGATGG - Intronic
1090366625 11:126211840-126211862 TAGGGAAGCCGGGCTGGGGCTGG + Intronic
1090399552 11:126440416-126440438 CAGGGACGGCGGGCGGGGGCCGG - Intronic
1091048477 11:132347213-132347235 TAGCGGGGGGGGGGGGGGGCGGG - Intergenic
1091407940 12:220695-220717 TTGGGAAGCTGGGTGGGGGCTGG - Exonic
1091770948 12:3150990-3151012 TAGCGAAGCTGGCTGGAGGCTGG - Intronic
1092405261 12:8217343-8217365 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1096407416 12:51354101-51354123 TAGGGAAGGCAGCTGGGGGAGGG - Exonic
1096656628 12:53096580-53096602 TGGGGAAGGCGGGTGGGGAGCGG + Intergenic
1098929744 12:76397342-76397364 TGGGGAGGGGGGGTGGGGGCAGG + Intronic
1101640796 12:106584613-106584635 TATGGAAGTGGGGTGGGGGCTGG + Intronic
1103704996 12:122866669-122866691 TGGTGAGGGCGGGTGGGCGCCGG - Exonic
1104074163 12:125374643-125374665 TAGAGAAGCCGGGGCGGGGCGGG - Intronic
1106028483 13:25977032-25977054 CAGGGAAGGGGGGTGGGGGTGGG - Intronic
1108575463 13:51786591-51786613 TTGCGGGGGCGGGTGGGGCCTGG - Intronic
1116821831 14:49634386-49634408 TAGCGAGGCTCGGTGGGGGCGGG + Exonic
1118366631 14:65102213-65102235 GGGCGACGGCGGGAGGGGGCCGG - Intronic
1118709887 14:68510368-68510390 TAGAGTAGGAGGCTGGGGGCGGG + Intronic
1118776985 14:68979331-68979353 GAGCCGAGGCGGGCGGGGGCGGG + Intronic
1119031602 14:71197095-71197117 TGGCGGAGGTGGGTGGGTGCAGG + Intergenic
1119364927 14:74083897-74083919 TAGTGAAGTAGGGTGGGGGAAGG + Intronic
1122618569 14:103038709-103038731 TAGAGACGGGGGGGGGGGGCGGG + Intronic
1122768175 14:104085570-104085592 CCGCGGAGGCGGGCGGGGGCAGG - Intergenic
1122807249 14:104266119-104266141 TAGGGAGTGCGGGTGAGGGCAGG + Intergenic
1122875146 14:104660480-104660502 AAGTGCAGGGGGGTGGGGGCAGG - Intergenic
1123030915 14:105450613-105450635 TGGCTGAGGCAGGTGGGGGCAGG + Intronic
1123035872 14:105471722-105471744 TAGAGTTGGCTGGTGGGGGCTGG - Intergenic
1124042040 15:26114511-26114533 TAGAGCAGGCGGTTGGGGGTTGG - Intergenic
1124538763 15:30567351-30567373 TGGTGGAGGCGGGGGGGGGCGGG + Intergenic
1127332022 15:57948985-57949007 GTGCCAAGGCGGGTGGGGACAGG - Intergenic
1127516918 15:59704625-59704647 AAGCCAAGGCGGGTGAGGTCAGG - Intergenic
1127772605 15:62243582-62243604 TGGCCAAGAAGGGTGGGGGCGGG - Intergenic
1128661774 15:69506593-69506615 TAGAGAAGAAGGCTGGGGGCTGG - Intergenic
1129092740 15:73168366-73168388 TAGAGACGGGGGGTGGGGGGGGG + Intronic
1129674235 15:77623666-77623688 AAGGGGAGGCAGGTGGGGGCGGG - Intronic
1132902634 16:2266671-2266693 ATTCGAAGGCGGGTGGGTGCAGG - Intronic
1133076212 16:3283060-3283082 TAGCCGAAGCGGGTGGGGCCTGG + Exonic
1133121742 16:3612572-3612594 TAGAGACGGGCGGTGGGGGCGGG + Intronic
1133232487 16:4373131-4373153 TGGGGCAGGCGGGTGGGGGATGG + Intronic
1134186032 16:12085621-12085643 TAGAGAAGTAGGGTGGGGGCTGG - Intronic
1140393277 16:74606765-74606787 GAGCGGGGGCTGGTGGGGGCTGG - Exonic
1141615801 16:85208752-85208774 TAGCGGATGGGGGTGGGGGTGGG + Intergenic
1141802446 16:86320034-86320056 TGCCGAAGGTGGGAGGGGGCGGG - Intergenic
1141964768 16:87434444-87434466 CAGCGAAGGCTGGTGGAGGAAGG - Intronic
1142018664 16:87766251-87766273 TAGCGACTGGGGGTGGGGGGTGG - Intergenic
1142284865 16:89167593-89167615 CAGTGGAGGCGGGTGGGGGAAGG - Intergenic
1142413209 16:89926429-89926451 TGGCCAAGGCAGGTGGGAGCGGG - Intronic
1142687388 17:1585563-1585585 TAGAGACGGGGAGTGGGGGCTGG + Intronic
1143096380 17:4480659-4480681 TGGAGAGGGCGGGTGGGGGAAGG + Intronic
1145982380 17:29020552-29020574 TGGGGCAGGGGGGTGGGGGCTGG + Intronic
1146064695 17:29625028-29625050 AAGAGAAGGAGGGTGGGGGTAGG - Intergenic
1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG + Intronic
1146629300 17:34458512-34458534 CAGGGAAGGCGGGTGAGGGGAGG - Intergenic
1146923362 17:36728275-36728297 TGGGGAAGGGGGGAGGGGGCAGG - Intergenic
1147316198 17:39621614-39621636 CAGGGCAGGTGGGTGGGGGCAGG - Intergenic
1147957094 17:44142121-44142143 TAGCGACGGCGGGTGGGCCTCGG - Exonic
1147966332 17:44196223-44196245 TGGGGAAGGGGGGTGGGGGAGGG - Intronic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149447508 17:56725034-56725056 TAGAGAAAGTGGGAGGGGGCAGG - Intergenic
1150497907 17:65623227-65623249 TGGTGAAGGTGGGTGGGGCCTGG + Intronic
1151657640 17:75503156-75503178 CAGCGAAGGCGGGCGCCGGCTGG - Exonic
1152157790 17:78646236-78646258 TAGCGAAGGGTGGTGGGACCTGG + Intergenic
1152356648 17:79810798-79810820 TGGCGGAGGGGGGTGGGGGGGGG - Intergenic
1152818778 17:82425022-82425044 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818796 17:82425097-82425119 TAGAGAAGGCCGGAGGAGGCTGG + Intronic
1152818811 17:82425157-82425179 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG + Intergenic
1158602653 18:58867904-58867926 GAGTCAAGGTGGGTGGGGGCAGG - Intronic
1158648190 18:59265628-59265650 TAGCGAAGGCGGGGAGGGGAAGG - Intergenic
1161106174 19:2445165-2445187 TTGCAAAGGCTGGTGGGGGCAGG - Intronic
1161204457 19:3033831-3033853 TAGAGATGGGGGGTGGGGGTTGG - Intronic
1161271910 19:3394521-3394543 TAGTGTAAGCGGGTGGGGGGTGG - Intronic
1161680255 19:5676601-5676623 TTGGGAAGGCGGGAAGGGGCTGG - Intronic
1161977196 19:7613203-7613225 GGGCGGGGGCGGGTGGGGGCGGG + Intronic
1163126761 19:15248417-15248439 TAGAGGAGGCGGGTGGGGTGAGG + Intronic
1163859970 19:19737752-19737774 TAGTGAAGGTGCGTGGGGGGAGG - Intergenic
1164562197 19:29300055-29300077 TAGGGAAGGCGGGCAGGAGCTGG + Intergenic
1164617765 19:29677019-29677041 TAGAGGAGGCTGGTGGTGGCCGG - Intergenic
1165154272 19:33777737-33777759 TAGGGAAGGGGGCAGGGGGCAGG + Intergenic
1165470941 19:36004193-36004215 TAGAGATGGGGGGAGGGGGCAGG + Intronic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG + Exonic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
1168344450 19:55643600-55643622 TAGGGAAGGAAGGTTGGGGCGGG - Intronic
925587071 2:5474951-5474973 CAGGGCAGGCGGGTGTGGGCGGG - Intergenic
925886810 2:8400662-8400684 TCAGGGAGGCGGGTGGGGGCGGG - Intergenic
926056933 2:9779208-9779230 AAGAGAAGGCGGGTGGTGGCCGG - Intergenic
926186710 2:10696404-10696426 TAGAGACGGCGGGGGGGGGGGGG + Intergenic
926233915 2:11025130-11025152 AAGCCAGGGTGGGTGGGGGCTGG - Intergenic
927612640 2:24557159-24557181 TAGCAACGGTGGGTTGGGGCGGG + Intronic
929860331 2:45671583-45671605 GAGAGAAGGCTGGTGGGGGGAGG - Intronic
932231862 2:70089586-70089608 TGGGGAAGGGGTGTGGGGGCAGG + Intergenic
932455667 2:71848259-71848281 GAGAGAAGGGGGGTGGGGGCGGG + Intergenic
932495232 2:72142856-72142878 AAGGGAACGGGGGTGGGGGCAGG + Intronic
934500621 2:94857797-94857819 CAGTGAGGGCGGGTGGGGGAAGG - Intergenic
934549326 2:95245441-95245463 TAGAGACGGCGGGGGGGGGGGGG + Intronic
940739496 2:157490876-157490898 TATTGAAGCTGGGTGGGGGCAGG - Intergenic
945033608 2:205686047-205686069 TAGAGAAGGCGCTGGGGGGCGGG - Intronic
946330477 2:219006116-219006138 TGGCGAGGGTGGCTGGGGGCAGG + Exonic
947395592 2:229683821-229683843 TAGGGATGGGGGCTGGGGGCTGG + Intronic
947435283 2:230067925-230067947 CACCGAGCGCGGGTGGGGGCGGG - Intronic
947575394 2:231269862-231269884 TAGGGGGGGAGGGTGGGGGCGGG - Intronic
948194702 2:236086851-236086873 TAGGGCAGGGGGGTGGGGGAGGG - Intronic
948367772 2:237469606-237469628 GAGCGAAGGCGGGGTGGGGGCGG + Intergenic
948751944 2:240138031-240138053 TAGAGAAGGGGAGTGGGGGGCGG + Intergenic
1168793492 20:595918-595940 CAGGGAAGGTGGGTGGGGGTGGG + Intergenic
1172028869 20:31968001-31968023 CAGCTCAGGCGGGTGGGGGCGGG + Exonic
1172118416 20:32584502-32584524 TGGGGCAGGCGGGCGGGGGCGGG - Intronic
1172301314 20:33852468-33852490 GAGAGATGGAGGGTGGGGGCGGG + Intronic
1174049617 20:47758603-47758625 CAGCGAAGGTGGGTGCGGGGAGG + Intronic
1176050848 20:63118939-63118961 TGGAGAAGGCAGGAGGGGGCGGG - Intergenic
1176312189 21:5157980-5158002 TAGGGGAGGCGGGTGGGGGAGGG - Intergenic
1178636521 21:34308528-34308550 TAATGAGGGTGGGTGGGGGCAGG + Intergenic
1179726680 21:43344883-43344905 TGGCAAGGTCGGGTGGGGGCTGG - Intergenic
1179844859 21:44104050-44104072 TAGGGGAGGCGGGTGGGGGAGGG + Exonic
1181311677 22:21948303-21948325 TAGAGATGGGGGGTGGGGGGGGG - Intronic
1181475505 22:23165413-23165435 CAGTGAAGGCGGTTTGGGGCTGG + Intergenic
1181533011 22:23527747-23527769 AAGCCAAGGAGGGTGAGGGCAGG + Intergenic
1183364921 22:37401863-37401885 TCGCCAAGGAGGCTGGGGGCGGG - Intronic
1183413117 22:37666839-37666861 CAGTGATGGTGGGTGGGGGCTGG + Exonic
1184034940 22:41913868-41913890 GAGGGCAGGGGGGTGGGGGCGGG - Intronic
1184676693 22:46046864-46046886 TAGCGCTGGCAGGTGGAGGCAGG - Intergenic
1185272478 22:49935573-49935595 TGGGGACGGAGGGTGGGGGCGGG + Intergenic
1185343617 22:50302108-50302130 TGGGGAAGTGGGGTGGGGGCAGG + Intronic
950094281 3:10319790-10319812 GAGAGAAGGCGGGGGGGGGGGGG + Intronic
950156277 3:10723772-10723794 TTGGGAAGGAGGGTGGGGGAGGG + Intergenic
953030628 3:39177698-39177720 TAGCGGGGGCGGGGGGGGGAGGG + Intergenic
953717728 3:45330292-45330314 AAGCGAAGGCTGGTGCTGGCTGG + Intergenic
954063313 3:48087532-48087554 TAGAGATGGGGGGCGGGGGCAGG - Intronic
954073157 3:48157996-48158018 CAGGGAAGGGGGGTGGGGGTAGG - Exonic
954223222 3:49166958-49166980 TTGCTCAGGCAGGTGGGGGCAGG + Intergenic
954256644 3:49411973-49411995 GAGCGAGGGCGGGCGGCGGCGGG + Exonic
954436965 3:50501384-50501406 TAGAGAATGAGGGTGGGGGTGGG - Intronic
955579804 3:60406662-60406684 TAGAGAAGGATGGTGGGGGGTGG + Intronic
958004928 3:87798534-87798556 TAGCTACGGCGGGTGGAGGGGGG - Intergenic
961543847 3:127618505-127618527 CAGAGATGGCGGGTGCGGGCCGG - Intronic
968967841 4:3778289-3778311 TGGCGAAGGTGGGTTGGGGTGGG + Intergenic
969760853 4:9180628-9180650 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
971154142 4:24064240-24064262 TAACGAAGAGGGGAGGGGGCTGG + Intergenic
975364427 4:73512246-73512268 TAGTGAGGGTGGGAGGGGGCAGG - Intergenic
975801213 4:78059880-78059902 TAGAGACGGGGGGCGGGGGCGGG + Intronic
977169878 4:93749056-93749078 TAGCAAAAGTGGGTGGGGGTGGG + Intronic
977586800 4:98783431-98783453 TTACAAAGGTGGGTGGGGGCAGG + Intergenic
979724346 4:123942550-123942572 CAGCAAATGGGGGTGGGGGCGGG - Intergenic
982187641 4:152819005-152819027 GAGCAAAGCTGGGTGGGGGCTGG - Intronic
985394844 4:189531244-189531266 AAGCAAAGGCAGGTGGGGGATGG + Intergenic
985818219 5:2142424-2142446 TAGCGAAAGCGGGTGTGTGAGGG + Intergenic
990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG + Intergenic
992735298 5:79713301-79713323 TTGTGACGGCGGGTGGGGGGTGG - Intronic
992910722 5:81393918-81393940 GAGCGGCGGCGGCTGGGGGCTGG - Intronic
993137551 5:83989311-83989333 TAGCTCATGGGGGTGGGGGCAGG - Intronic
995540778 5:113183903-113183925 TTGTGAAGATGGGTGGGGGCGGG - Intronic
1001506642 5:172284598-172284620 TAGGGAAGACGGGGGTGGGCAGG - Intergenic
1002472182 5:179442106-179442128 TAGCAAAGGAGGGTGTAGGCCGG - Intergenic
1002487867 5:179551667-179551689 TATGGGAGGGGGGTGGGGGCGGG - Intronic
1003377493 6:5593293-5593315 CAGCAGAGGCCGGTGGGGGCGGG - Intronic
1004009065 6:11663920-11663942 TAGGGGAGGCGGGCGGGGGGCGG + Intergenic
1005140465 6:22626181-22626203 CAGGAAAGGAGGGTGGGGGCTGG - Intergenic
1005347918 6:24908741-24908763 AAGCCAAGGAGGCTGGGGGCGGG - Intronic
1007383117 6:41503273-41503295 GAGCGAAGACGGCCGGGGGCAGG + Intergenic
1007967453 6:46015740-46015762 GAGCGAAGCCGGGAGGAGGCGGG + Intronic
1008449663 6:51635849-51635871 TGGTGAAGGTGGGGGGGGGCGGG + Intronic
1008920876 6:56843481-56843503 CGGCGAGGGCGGGCGGGGGCCGG + Intronic
1012945571 6:105461970-105461992 TTAAGAAGGTGGGTGGGGGCAGG - Intergenic
1014187974 6:118457588-118457610 AACAGAAGGCGGGTGGGGGTGGG - Intergenic
1016031634 6:139344196-139344218 GAGCAAAGCCAGGTGGGGGCTGG - Intergenic
1016863831 6:148747301-148747323 GAGGGCAGCCGGGTGGGGGCGGG - Intergenic
1016981711 6:149860733-149860755 TAGGGAAGGCGGGAGGATGCAGG - Intronic
1018136115 6:160779833-160779855 TAGGGAAGCGGGGTGGGGGGGGG - Intergenic
1019187778 6:170230949-170230971 TAGGGAAGGAGGGTGGAGTCTGG + Intergenic
1019281508 7:202696-202718 TAGCGAGGACGGGTGGCTGCTGG + Intronic
1019478367 7:1254930-1254952 GTGGGAGGGCGGGTGGGGGCTGG + Intergenic
1019578150 7:1747360-1747382 TAGGGATGGGGGGTGGGGGTGGG + Exonic
1019689611 7:2403440-2403462 TCGCGAGGGCGGGGGCGGGCGGG + Intergenic
1020296764 7:6763873-6763895 AAGCGTTGGGGGGTGGGGGCGGG - Intronic
1026141622 7:67711825-67711847 TAGGGAAGGTGAGTGGGAGCCGG + Intergenic
1027374891 7:77538528-77538550 TGGCGGAGGCGGGGGGGCGCTGG - Intronic
1028013144 7:85675086-85675108 TGGGGAAGGCGGATGGGGGAGGG - Intergenic
1029537107 7:101163330-101163352 GAGCGGACGTGGGTGGGGGCGGG + Exonic
1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG + Intronic
1030227680 7:107169837-107169859 TGGCGAAAGAGGGTGGGGGATGG + Intronic
1032491079 7:132325058-132325080 AGGTGAAGGCAGGTGGGGGCAGG - Intronic
1033409330 7:141102936-141102958 TGGCTAAGGCGGGTGGAGCCAGG + Intronic
1033783934 7:144706971-144706993 TAGCGAAAGCAGGTGGAGGGAGG + Intronic
1034441007 7:151086206-151086228 GAGGCAATGCGGGTGGGGGCTGG + Intronic
1036270962 8:7302479-7302501 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
1036350387 8:8007865-8007887 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1036565349 8:9933745-9933767 GAGCAGAGGCGGGAGGGGGCGGG - Intergenic
1036675535 8:10828876-10828898 TAGCGTAGGGGTGTGAGGGCCGG - Intronic
1037837360 8:22222001-22222023 TAGTGGAGGCGGCTGGGGGAGGG - Intronic
1038575751 8:28701935-28701957 GAGAGAGGGCGTGTGGGGGCGGG - Intronic
1038596460 8:28890577-28890599 GAGGGAAGGCGGGAGGGGGAGGG - Exonic
1039622341 8:39009889-39009911 TAGTGATGGGGGGGGGGGGCAGG + Intronic
1039883967 8:41645275-41645297 TGGGGGAGGCGGGTGAGGGCTGG - Exonic
1041690043 8:60679220-60679242 GGGCGAGGGCGGGAGGGGGCCGG + Intronic
1042217024 8:66437536-66437558 TGGGGGAGGGGGGTGGGGGCAGG - Intronic
1042911888 8:73836256-73836278 TAGCTAAGAAGGCTGGGGGCTGG - Intronic
1047019433 8:120759065-120759087 TAGCTAAAGTGGGTTGGGGCTGG - Intronic
1047676180 8:127205758-127205780 TAGCAGTGGCGGGCGGGGGCCGG + Intergenic
1048284045 8:133127788-133127810 GAGCCAGGGCAGGTGGGGGCTGG - Intronic
1048480406 8:134785491-134785513 TGGCGGAGGGGGGAGGGGGCGGG - Intergenic
1049306253 8:141905865-141905887 TGGCCAAGGGGCGTGGGGGCGGG + Intergenic
1049584999 8:143428956-143428978 GAACGAAGGAGGGCGGGGGCAGG + Exonic
1049613676 8:143567304-143567326 CGGCGAAGACTGGTGGGGGCCGG + Exonic
1049615869 8:143575637-143575659 CAGGGAAGGCTGTTGGGGGCAGG + Exonic
1049659438 8:143813188-143813210 GAGGGCAGGCGGGTGGGAGCTGG - Intronic
1049988319 9:971856-971878 GAGGGCAGGCGGGTGGGGGAGGG - Intergenic
1052559744 9:30070050-30070072 TTGGGAAGCCGGGTGGGGGGAGG + Intergenic
1053656553 9:40222751-40222773 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1053906904 9:42851969-42851991 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1054368656 9:64368973-64368995 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1054528063 9:66153534-66153556 CAGTGAGGGCGGGTGGGGGAAGG - Intergenic
1054676284 9:67858725-67858747 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1056395359 9:86176529-86176551 TGGGGAAGGCGGTGGGGGGCAGG - Intergenic
1061255710 9:129453504-129453526 TAGGGATGGAGGGTGGGGGATGG + Intergenic
1061262657 9:129488602-129488624 CCGCGAGGGCGGGAGGGGGCCGG - Intergenic
1062395229 9:136350129-136350151 CAACAAAGGAGGGTGGGGGCTGG - Intronic
1062539950 9:137037182-137037204 CAGGGAAAGCGGGTGGGTGCAGG - Exonic
1062567195 9:137168551-137168573 GAGCGAGGGCGGGGGCGGGCGGG - Exonic
1062597450 9:137305657-137305679 AAGTGAGGGCGGGTGGAGGCGGG + Intergenic
1062629309 9:137456596-137456618 CAGCCAGGGCGGGTGGGGGGAGG + Intronic
1062698662 9:137888105-137888127 TAGGGAAGGAGAGTGGGAGCCGG + Intronic
1186973596 X:14875381-14875403 TGAGGATGGCGGGTGGGGGCTGG - Intronic
1188001851 X:24989744-24989766 TAGCCATGGGGGGTGGGGGTGGG + Intronic
1188141475 X:26557635-26557657 TAGGGAAGGCCGGGCGGGGCTGG - Intergenic
1189354240 X:40299153-40299175 TGGCAAAGTGGGGTGGGGGCAGG - Intergenic
1190740941 X:53288386-53288408 TAGGGAAGGAGGGAGGGGGTGGG - Intronic
1195654700 X:107323779-107323801 TAGGGAGGGTGGGCGGGGGCGGG - Intergenic
1197789726 X:130241991-130242013 TTGGGAAGCCGGGGGGGGGCGGG + Intronic
1198112284 X:133512594-133512616 GAACCAAGGAGGGTGGGGGCGGG - Intergenic
1201622306 Y:15973528-15973550 TAGTGAGGGCGGCGGGGGGCGGG + Intergenic