ID: 1166111445

View in Genome Browser
Species Human (GRCh38)
Location 19:40625752-40625774
Sequence GCTGATAGGCAGAGGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166111440_1166111445 10 Left 1166111440 19:40625719-40625741 CCAGAGTTAGATCACAGCTGATG 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1166111445 19:40625752-40625774 GCTGATAGGCAGAGGGTGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 308
1166111439_1166111445 23 Left 1166111439 19:40625706-40625728 CCTCAGAGAACTTCCAGAGTTAG 0: 1
1: 0
2: 2
3: 12
4: 188
Right 1166111445 19:40625752-40625774 GCTGATAGGCAGAGGGTGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166111445 Original CRISPR GCTGATAGGCAGAGGGTGCC TGG Intronic
900092491 1:926476-926498 GCTGAAGGCCAGAGGGTGCAAGG + Intronic
900388784 1:2424347-2424369 GATGATGGCCAAAGGGTGCCAGG - Intergenic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900999958 1:6143983-6144005 GCTGCTAGGCACAGGCTGCCGGG - Intronic
901128407 1:6945640-6945662 GCTAAAAGGCATAGGGTGGCTGG - Intronic
901278228 1:8009852-8009874 GTTGACAGGCAGAAGGTGCTAGG + Intronic
901779997 1:11587626-11587648 GCTTATAGCCAGATGGTGGCTGG - Intergenic
902116023 1:14121911-14121933 GCCCAGAGGCAGAAGGTGCCTGG + Intergenic
902478913 1:16701597-16701619 TCTGGGAGGCAGAGGGGGCCGGG - Intergenic
903192777 1:21666197-21666219 TCTCAGAGGCACAGGGTGCCAGG + Intronic
903223017 1:21879349-21879371 GCAGATTGGAAGAGGGTGGCAGG - Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903787109 1:25868632-25868654 CCTCAGAGGCAGAGGTTGCCGGG + Intronic
904787824 1:32995845-32995867 GCAGGTTGGCAGAGGGTGCAAGG + Intergenic
904797930 1:33071475-33071497 GCTCAAAGGCAGAGCTTGCCGGG - Intronic
908829015 1:68161798-68161820 GCTGGTTGGGAGAGGGCGCCTGG + Intronic
909696005 1:78468741-78468763 GCTGAAAGGCTGAAGGTGCTTGG - Intronic
910390283 1:86735901-86735923 GCAGAAAAGCAGAAGGTGCCTGG + Intronic
910688166 1:89939484-89939506 CCTGAGAGGCAGATGGTTCCTGG - Intergenic
911618902 1:100044589-100044611 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
912963060 1:114213189-114213211 GCAGATAGGCTGAGAGTGACAGG + Intergenic
913449830 1:118985608-118985630 GCAGAAAGCCAGAGGGTGCTGGG + Intronic
914517809 1:148388899-148388921 GCAGAAAGGCAGATGGGGCCTGG - Intergenic
915996818 1:160572056-160572078 GGTGATAGGAAGAGGCTGCTTGG + Intronic
916195523 1:162218748-162218770 GCTGGAAGGGACAGGGTGCCCGG - Intronic
916824364 1:168429953-168429975 TCTGAGGGGCAGAGGCTGCCTGG + Intergenic
920066487 1:203273236-203273258 GCTCACCGGCAGAGGGCGCCAGG + Intronic
921306045 1:213798121-213798143 TCTGATAGGCACTGGGAGCCTGG - Intergenic
922462482 1:225824091-225824113 GCAGATAGAGAGTGGGTGCCTGG + Intronic
922774386 1:228208118-228208140 GCTGGGAGGCAGGGGCTGCCGGG - Exonic
923641938 1:235772147-235772169 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
1063308804 10:4933611-4933633 CCTGGTAGGCAGTGGGTGCCTGG - Intronic
1063400333 10:5737542-5737564 CCTGAAGGGCAGAGGTTGCCTGG - Intronic
1063660026 10:8028931-8028953 CCTGAGAGGCAGAGGTTGCAAGG - Intergenic
1066708074 10:38202692-38202714 GCTGGTAGGTAGAGAGAGCCAGG + Intergenic
1066981431 10:42419876-42419898 GCTGGTAGGCAGAGTGAGCCAGG - Intergenic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1069086892 10:64151117-64151139 GCTGGTGGGCAGAGGGTGTAGGG - Intergenic
1071290556 10:84185819-84185841 GCTGATGGGCAGAGATTCCCTGG + Intergenic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072623813 10:97098368-97098390 GCTGCTAGGCAGAGAGGGGCAGG + Intronic
1074715618 10:116215874-116215896 GCTGGTGGGGAGAGGGAGCCGGG - Intronic
1076570922 10:131432397-131432419 GCTGGGAGGCAGCGGGTGTCGGG + Intergenic
1077259081 11:1606138-1606160 GATGGTAGGCAGTGAGTGCCTGG - Intergenic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1080488625 11:32737540-32737562 TCTGGGAGGCAGAGGTTGCCTGG + Intronic
1081087874 11:38823729-38823751 GCAGCTTGGCAGAGGGTTCCGGG - Intergenic
1083332792 11:61906733-61906755 GCTGATAGGCGGTGGCAGCCAGG - Intronic
1083403480 11:62440704-62440726 GCAGAGAGCCAGAGGGAGCCTGG + Intronic
1083768565 11:64853937-64853959 GCTGCTAGGCTGAGGCTGCATGG - Exonic
1083823071 11:65183295-65183317 GCTGATAGCCAGATCCTGCCTGG - Intronic
1084326388 11:68402784-68402806 GCTGACAGGCAGCGGCTGCCTGG - Intronic
1089659007 11:119973792-119973814 TCTGAGAGGCAGAGGGGGCCTGG + Intergenic
1089774847 11:120828950-120828972 GCTGCCTGGCAGAGGCTGCCGGG - Intronic
1091299358 11:134497732-134497754 GCTGAGTGGCAGAGCGTGCCTGG + Intergenic
1091995408 12:4989023-4989045 GCTGATAGGCAGAGGCAGAAAGG - Intergenic
1092262203 12:6958765-6958787 GATGAGAGGCAGTGGGTGCAGGG + Intronic
1092648045 12:10601151-10601173 GATGATAGGAAGTGGGTGACAGG + Intergenic
1093745941 12:22741394-22741416 CCGGAGAGGCAGAGGTTGCCAGG - Intergenic
1095969690 12:47893028-47893050 GGAGAGAGGGAGAGGGTGCCAGG + Intronic
1097890993 12:64777833-64777855 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1098466172 12:70788779-70788801 CATGATAGGCAGAGGGTCCTCGG - Intronic
1101079724 12:101170750-101170772 GCAGGGAGGCAAAGGGTGCCTGG - Intronic
1102572476 12:113835520-113835542 GCTGGGAGGCAGTGGGGGCCGGG + Intronic
1104053793 12:125214277-125214299 GCTGAGAGACAGAGGGAGGCTGG - Intronic
1106416942 13:29553742-29553764 GCTGACAGGCAGACTGTACCTGG + Exonic
1106476262 13:30100813-30100835 CCTGATAGACAGAAGGTGCTTGG - Intergenic
1106708973 13:32311381-32311403 GCTGACAGGCAGGAGGAGCCCGG - Exonic
1108506252 13:51115371-51115393 CCTGAAAGGGACAGGGTGCCTGG - Intergenic
1108592122 13:51921571-51921593 GCTCCGAGGAAGAGGGTGCCTGG - Intergenic
1113291897 13:108916290-108916312 GCAGCTAAGCAGAGGGTGCAAGG + Intronic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1115747530 14:36452524-36452546 GCTGAAATCCAGATGGTGCCAGG - Intergenic
1118468624 14:66054535-66054557 GGAGAAAGGCAGAGAGTGCCTGG - Intergenic
1118476331 14:66120860-66120882 TCTGACAGGCATAGGGGGCCAGG + Intergenic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1121711820 14:96044095-96044117 GCTGATCCACAGAGGGTCCCTGG - Intronic
1121731826 14:96192777-96192799 GCTCAGAGGCAGAGAATGCCAGG + Intergenic
1122379485 14:101291614-101291636 ACTGATGGGCAGAGAGGGCCAGG + Intergenic
1122774938 14:104112953-104112975 GGAGATGGGCAGAGGGTGTCTGG - Exonic
1122970732 14:105151169-105151191 GCTGCTGGGCTGCGGGTGCCAGG - Intronic
1126878286 15:53067476-53067498 GCTGATTGGCAGAAGGAGGCTGG + Intergenic
1129258055 15:74345388-74345410 GGTGAGAGGCAGAGGGTGCTCGG - Intronic
1129886533 15:79041917-79041939 ACTGATTGGCAGTGGCTGCCTGG - Intronic
1130397182 15:83512785-83512807 GCTGATAGGGAGAGGGAGGGAGG - Intronic
1137767805 16:50991401-50991423 GCTGGCAGGCAGAGGCTGCAGGG - Intergenic
1138199262 16:55077062-55077084 GCTGGTAGGAACTGGGTGCCAGG - Intergenic
1140312097 16:73859406-73859428 GCTGATAGGCAGAGAGAGACAGG - Intergenic
1140841941 16:78848001-78848023 GCTGATAGCCTGTCGGTGCCTGG + Intronic
1141427530 16:83953589-83953611 GCTGCTTGGCTGAGGGTACCAGG - Intronic
1142325682 16:89413032-89413054 GTTGATGGGCAGAGAGTCCCAGG - Intronic
1142340140 16:89516473-89516495 CCTGGTAGGCAGAGGTTGCAGGG + Intronic
1142408530 16:89904430-89904452 GCTCATATAAAGAGGGTGCCAGG + Intronic
1142900713 17:3009748-3009770 GCTGATGGACAGTGGGAGCCCGG + Intronic
1143204580 17:5133062-5133084 TCTGAGAGGCTGACGGTGCCAGG - Intronic
1143831286 17:9653705-9653727 GCTGAACGACAGAGGGTGCTTGG + Intronic
1144494568 17:15738149-15738171 ACTGAGAGGCAGACGGTGCCAGG - Intronic
1144639431 17:16929427-16929449 GCTGAGAGGCAGATGGTGCCAGG + Intergenic
1144875648 17:18395747-18395769 TCTGAGAGGCTGACGGTGCCAGG - Intergenic
1145156578 17:20548674-20548696 TCTGAGAGGCTGACGGTGCCAGG + Intergenic
1145264440 17:21372920-21372942 GCTGAGAGGGGGAGGGTGTCTGG + Intergenic
1145760306 17:27421780-27421802 TCTGAGAGGCTGACGGTGCCAGG - Intergenic
1146547536 17:33751862-33751884 GCTGAGAGGCAGCGGGAGGCTGG + Intronic
1146844080 17:36172760-36172782 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1146856385 17:36260695-36260717 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1146864231 17:36327680-36327702 TCTGAGAGGCTGATGGTGCCAGG - Intronic
1146872295 17:36384606-36384628 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1146879654 17:36435691-36435713 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1146883578 17:36456834-36456856 TCTGAGAGGCTGACGGTGCCAGG + Intergenic
1147067092 17:37928268-37928290 TCTGAGAGGCTGATGGTGCCAGG - Intronic
1147075179 17:37985230-37985252 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1147078624 17:38007829-38007851 TCTGAGAGGCTGATGGTGCCAGG - Intronic
1147086704 17:38064776-38064798 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1147094562 17:38131764-38131786 TCTGAGAGGCTGATGGTGCCAGG - Intergenic
1147102649 17:38188739-38188761 TCTGAGAGGCTGATGGTGCCAGG + Intergenic
1147250551 17:39150708-39150730 GCTGAAAGCCAAAGGCTGCCAGG + Intronic
1148138653 17:45312263-45312285 GGTGAGAGGCAGAGTGTGCCTGG - Intronic
1148229176 17:45920541-45920563 GCTGCCAGGCAGAAGGTGCACGG - Intronic
1148793711 17:50187389-50187411 CCAGAGAGGCAAAGGGTGCCTGG + Intronic
1148926384 17:51089749-51089771 TCTGGTAGGCAGAGGTTGCAGGG - Intronic
1149521056 17:57318581-57318603 GCTTGAAGGCAGAGGGTGCTGGG + Intronic
1150506467 17:65703602-65703624 GCTGAGAGGCAGAGGGACCTGGG - Intronic
1150626796 17:66847178-66847200 TCTGGGAGACAGAGGGTGCCAGG - Intronic
1151868807 17:76822616-76822638 GCTCATACCCAGAGGGTGCTAGG - Intergenic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152255663 17:79238010-79238032 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1152571125 17:81121721-81121743 GCTCCTGGGCAGAGGCTGCCTGG + Exonic
1152673380 17:81623116-81623138 GCTGGGAGGCAGAGGTTGCAGGG + Intronic
1152809741 17:82375792-82375814 GCTGAGAGGAGGAGGGTCCCGGG - Intergenic
1153377797 18:4400433-4400455 GCTAATGGGCAGATGATGCCTGG + Intronic
1153613349 18:6910073-6910095 GCTGAGGGGCAGAGTGTGCCTGG - Intronic
1154042018 18:10865397-10865419 GCTGAGAGGCAGTGGCTGCTTGG + Intronic
1154071111 18:11151960-11151982 GCAGAGAGGCATAGGGTGTCTGG - Intergenic
1155926331 18:31659466-31659488 GCTGCTAAGCAGAGGGTGTTGGG + Intronic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1157818807 18:50750610-50750632 GCAGATACCCAGAGGGTCCCTGG + Intergenic
1158005489 18:52667653-52667675 GCTGTTATGCAGAGCGTGACTGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161785842 19:6325090-6325112 GCAGATGGGCAGAGAGAGCCAGG - Intronic
1163079425 19:14926589-14926611 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1163234139 19:16021234-16021256 TCTGAGAGGCTGGGGGTGCCAGG - Intergenic
1163251636 19:16129357-16129379 GGTGGGAGGCAGAGGGAGCCGGG + Intronic
1163284071 19:16335395-16335417 GCAGAGAGGCAGAGGCTGTCAGG + Intergenic
1165103858 19:33457129-33457151 GATGAAAAGCAGAGGGTGCCAGG + Intronic
1165118149 19:33541560-33541582 TCTGATACGTAAAGGGTGCCAGG - Intergenic
1166111445 19:40625752-40625774 GCTGATAGGCAGAGGGTGCCTGG + Intronic
1166406189 19:42523465-42523487 GGTGACAGGCAGGGGCTGCCTGG + Intronic
1167159346 19:47756917-47756939 ACTGAAAGGCAGGGGGTGTCAGG + Intronic
1167262752 19:48468261-48468283 TCTGAGCGGCAGAAGGTGCCAGG + Intronic
1167624800 19:50580632-50580654 GCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1167764191 19:51469319-51469341 TCTCTTAGGCAGAGGGTTCCTGG + Intergenic
1168102247 19:54147467-54147489 GCTGCTTGGCAGTGGGGGCCTGG - Intronic
1202712954 1_KI270714v1_random:27504-27526 TCTGGGAGGCAGAGGGGGCCGGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925603642 2:5635736-5635758 GCTGAGAGCCAGACGATGCCTGG + Intergenic
926552188 2:14314171-14314193 TCTGATAGGAAGATAGTGCCTGG - Intergenic
926566198 2:14477147-14477169 ACTGGGAGGCAGAGGTTGCCAGG + Intergenic
926797701 2:16632379-16632401 GCTGAAGTTCAGAGGGTGCCTGG + Intronic
926890252 2:17633441-17633463 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
930206132 2:48587976-48587998 GCAGAGAGTGAGAGGGTGCCAGG + Intronic
930787078 2:55281698-55281720 GCAGATAGGCAGGCGGTGCCCGG - Intergenic
931284419 2:60820233-60820255 GCGGAAAGGCAGAGGGTCCACGG - Intergenic
934078292 2:88446684-88446706 GCTAAAAGGGAGAGGATGCCAGG + Intergenic
934490901 2:94761530-94761552 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
935090517 2:99891063-99891085 GCTGGGAGGTAGAGGGAGCCAGG + Intronic
935588475 2:104823506-104823528 GCTGATTGGCAGAGTTTGGCAGG + Intergenic
937234905 2:120424962-120424984 GATGATGGGGAGAGGGTGCTGGG + Intergenic
938207598 2:129437490-129437512 GCAGATGGGCAGCAGGTGCCAGG - Intergenic
938278820 2:130050675-130050697 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
939118296 2:138086966-138086988 GTTGATAAGCAAAGGCTGCCTGG + Intergenic
939982678 2:148799715-148799737 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
941586599 2:167366910-167366932 GCACAAAGGCAGAAGGTGCCAGG + Intergenic
941991707 2:171563357-171563379 GCTGATAGAGACAGGGAGCCAGG - Intergenic
942324537 2:174764888-174764910 AGTGTTAGGCTGAGGGTGCCGGG + Intergenic
942756865 2:179351485-179351507 GCTGAGAGACAGAGGTGGCCAGG + Intergenic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
943732555 2:191318211-191318233 GCTGAGAGGCAGGGAGTTCCAGG + Intronic
944692278 2:202169059-202169081 GCTGGCAGGCAGGGGGTCCCTGG + Intronic
945065637 2:205945635-205945657 GCTGAGAGGCAGAGGCTGGTAGG - Intergenic
945110127 2:206354948-206354970 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
946372551 2:219289809-219289831 GCTGAGAAGCAGGGGGAGCCGGG + Exonic
948062547 2:235052361-235052383 GATGATGTGCAGAGCGTGCCAGG - Intronic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
948955739 2:241289315-241289337 ACTGATAGGAAGAGAGTACCTGG - Intronic
949046475 2:241874697-241874719 CCCGGTAAGCAGAGGGTGCCGGG - Intergenic
1169251207 20:4062817-4062839 GCTGATTGGCAGGGGGTGGAGGG + Intergenic
1170004069 20:11646750-11646772 CCTGAGAGGCCGAGGGGGCCTGG - Intergenic
1170822724 20:19767847-19767869 CCTGAGAGGCAGAGGTTGCAGGG + Intergenic
1172035416 20:32007297-32007319 GTTGATTGGCAGGGGCTGCCTGG - Intergenic
1172600211 20:36178042-36178064 GCTGACAGCCAGAAGGTACCTGG + Exonic
1172619088 20:36307622-36307644 GCTGATGGGGAGAGGGTTCCTGG + Intronic
1172619135 20:36307782-36307804 GCTCAGAGGCAGAGAGAGCCAGG - Intronic
1173272469 20:41550303-41550325 GCTGATAGGCAGACGCTACATGG - Intronic
1173458361 20:43222053-43222075 GCTGTGAGCTAGAGGGTGCCTGG - Intergenic
1174079021 20:47957851-47957873 GCAGAAAGGCAGAAGGAGCCAGG - Intergenic
1174180721 20:48672651-48672673 GCTCTTAGGCAGAGCGAGCCAGG - Intronic
1175753847 20:61516882-61516904 GTTGACAGGCTGAGGGTGCCTGG - Intronic
1175787915 20:61723642-61723664 GCTGACAGGGAGAGGTTTCCTGG + Intronic
1175925390 20:62468829-62468851 GCTGGGAGGGAGATGGTGCCTGG + Intronic
1176109451 20:63404801-63404823 GCAGACAGGCAGTGGGAGCCTGG + Intergenic
1176341302 21:5698170-5698192 GCTGGTTGGGAGAGGGTGCTTGG - Intergenic
1176473556 21:7130323-7130345 GCTGGTTGGGAGAGGGTGCTTGG - Intergenic
1176503525 21:7626286-7626308 GCTGGTTGGGAGAGGGTGCTTGG + Intergenic
1176688790 21:9880087-9880109 GGTGATGAGCAGAGGGTGTCAGG + Intergenic
1177860657 21:26449437-26449459 AATGATAGGCAGACGGTGCTTGG + Intergenic
1179483131 21:41691242-41691264 GATAATAGGTGGAGGGTGCCTGG + Intergenic
1179595166 21:42438398-42438420 GCTGTCAGGCAGAGGGGCCCAGG + Intronic
1179674591 21:42973452-42973474 GCTGATTGCTAGAGGGAGCCTGG - Intergenic
1180185234 21:46135931-46135953 GGTGACAGGGAGGGGGTGCCGGG - Intergenic
1181164594 22:20976626-20976648 GGTGATGGGCAGGGGGTGGCAGG - Intronic
1181620601 22:24088530-24088552 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
1181760098 22:25052276-25052298 GCTGTCTTGCAGAGGGTGCCTGG + Intronic
1183686244 22:39362834-39362856 TCTGATAGTCAGAGAGGGCCAGG - Intronic
1184616184 22:45640150-45640172 GTGGGGAGGCAGAGGGTGCCAGG + Intergenic
1203240565 22_KI270733v1_random:12634-12656 GCTGGTTGGGAGAGGGTGCTTGG - Intergenic
949895109 3:8762752-8762774 GCTGACAGGCACAGGAGGCCTGG - Intronic
950421549 3:12902564-12902586 GCTGACATGCACAGGGTTCCAGG + Intronic
951897454 3:27623742-27623764 GCTGAGAGGCAGAGGGACACTGG - Intergenic
952959893 3:38582667-38582689 GCTGATAGGTATGGGGTCCCTGG - Intronic
953842499 3:46400455-46400477 GCTGATAGTCAGAGGCTGGAAGG + Intergenic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
953874594 3:46659396-46659418 GCTGCTAGGCAGCTGTTGCCTGG + Intergenic
954108237 3:48420454-48420476 GCTGAGAGGCAGGGGATGTCTGG - Intronic
954629026 3:52038314-52038336 GCTCCTTGGCAGAGGCTGCCAGG - Intergenic
961474349 3:127137408-127137430 GCTGATAGCCAGCCTGTGCCAGG + Intergenic
961649941 3:128412331-128412353 GCTGCTCGGCAGAGGAGGCCAGG - Intergenic
963948108 3:151168779-151168801 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
964292490 3:155196758-155196780 GCTCAGAGGCAGAAGGTCCCTGG - Intergenic
966887769 3:184386325-184386347 GCTGCCAGGGATAGGGTGCCGGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967934039 3:194712224-194712246 GCTGACAGGTAGAGGGAGACAGG + Intergenic
968473186 4:791295-791317 GCTGATGGGGAGTGGGGGCCGGG - Intronic
968658673 4:1789756-1789778 GGTGAGTGGCAGAGGGTGCCTGG - Intergenic
969246706 4:5939282-5939304 GCTGATGGGCAGGTGGTGACTGG - Intronic
969442947 4:7227946-7227968 GCTGTGAGGCAGGGGGTGGCGGG + Intronic
971287898 4:25307985-25308007 ACTGGAAGGCAGAGGCTGCCGGG + Intergenic
978763301 4:112378957-112378979 GCTGACAGGCACATGGAGCCAGG - Intronic
980352175 4:131697901-131697923 GGTGATGAGCAGAGGGTGTCAGG + Intergenic
984472473 4:180194056-180194078 GCTCACAGCCAGATGGTGCCTGG + Intergenic
985765995 5:1779894-1779916 GCTGACAGGCAGTGGGGACCAGG - Intergenic
986515775 5:8562254-8562276 GGTTATAGTCAGATGGTGCCTGG + Intergenic
986585969 5:9318986-9319008 CCTGAGAGGCAGAGGTTGCCAGG + Intronic
992453186 5:76891748-76891770 GTAGATAGACAGAGGGTGCAGGG + Intronic
992938702 5:81739565-81739587 CCTGATGGGCAGAGATTGCCAGG + Intronic
994042367 5:95273725-95273747 GCAGAATGGCTGAGGGTGCCAGG - Intronic
994070190 5:95592622-95592644 ACTGTTAGGCAGAGGTTGCAGGG - Intronic
997576480 5:134981408-134981430 GCTGGGAGGCAGAGGTTGCAGGG + Intronic
997579892 5:135010628-135010650 GCTGATGGGCAGTGGGTGGGTGG + Intronic
999230913 5:150061314-150061336 GCCGGGAGTCAGAGGGTGCCTGG + Intronic
1001488908 5:172141734-172141756 GCATATAGGCTGAGGTTGCCAGG - Intronic
1001766551 5:174252354-174252376 GTTGATTGGCAGAGGCTGCCTGG + Intergenic
1002934228 6:1658027-1658049 GCTCAGAGGCAGGGAGTGCCGGG + Intronic
1003812915 6:9804658-9804680 GCTGATAGGCAGAAGAAGACAGG + Intronic
1004429353 6:15529898-15529920 GCTGAGCAGCAGAGGGGGCCTGG - Intronic
1004468050 6:15904029-15904051 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1004766705 6:18737054-18737076 GCTGATAGGCTGAATGTGCAGGG + Intergenic
1005599027 6:27407422-27407444 GCAGATGGGCAGGGGGAGCCGGG - Intergenic
1006373430 6:33659061-33659083 GCTGGCATGCAGAGGCTGCCCGG - Exonic
1008457509 6:51727826-51727848 ACAGATTGGCAGATGGTGCCAGG - Intronic
1011559749 6:88602600-88602622 GCTGATCAGAAAAGGGTGCCTGG - Intergenic
1012114924 6:95285055-95285077 GGTGATAGGCAGAGTGTCCCAGG + Intergenic
1013127932 6:107203310-107203332 TCTGATAGGGAGAGGCTGACAGG - Intronic
1013485896 6:110595658-110595680 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1015700691 6:136033105-136033127 GGCTATAGTCAGAGGGTGCCAGG + Intronic
1016300982 6:142631493-142631515 ACTGATAGGCAGAGAGGCCCTGG + Intergenic
1017959677 6:159210796-159210818 GCTGATAGCCAGATGGGGGCAGG - Intronic
1019175854 6:170159243-170159265 GCTTAGAGGGAGAGGATGCCCGG - Intergenic
1019472475 7:1228349-1228371 GCTGAGAGGGAGAGGGAGACGGG - Intergenic
1019612959 7:1946132-1946154 GCGGATGGGCAGATGGGGCCTGG - Intronic
1019775413 7:2909527-2909549 GGTGAGAGGCAGAGGGTGAGGGG - Intronic
1020072146 7:5234136-5234158 CCTGGGAGGCAGAGGTTGCCAGG + Intergenic
1022992235 7:35720007-35720029 ACTGATAGGCTGAGGATGGCAGG - Intergenic
1023024472 7:36038352-36038374 TCTGTTAGGCAGTGGGTGCCAGG + Intergenic
1023862639 7:44225427-44225449 GCTGATAGGGTCGGGGTGCCTGG - Intronic
1023882741 7:44329705-44329727 CCTGGTAGCCAGAGAGTGCCAGG - Intronic
1024057336 7:45670384-45670406 GCTGACAGGCAGAGGATGCTGGG + Intronic
1024241349 7:47438839-47438861 GCAGGTAGAGAGAGGGTGCCAGG + Intronic
1024530258 7:50385457-50385479 GCTGACAGCAAGAGGGTGCTGGG + Intronic
1026339607 7:69424130-69424152 GCTGAGAGGAAGTGGCTGCCTGG + Intergenic
1026772563 7:73211678-73211700 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027013427 7:74765078-74765100 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027074611 7:75180955-75180977 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1027201403 7:76066075-76066097 GCTCAGAGCCAGAGGGTGCCAGG - Intronic
1027218919 7:76201928-76201950 GCGGGGAGGCAGAGGGTGCGGGG + Exonic
1027419352 7:78004671-78004693 GCAGAGAGGCAGAGGGAGTCTGG + Intergenic
1029527437 7:101103632-101103654 GGTGGAAGGCAGGGGGTGCCAGG - Intergenic
1029570268 7:101363887-101363909 GCTGATAGGAGAGGGGTGCCCGG - Intronic
1029585279 7:101466917-101466939 CCTGTCAGGTAGAGGGTGCCAGG + Intronic
1031381898 7:121096779-121096801 GCTGATATGGAAAGGATGCCAGG + Intronic
1032391925 7:131560851-131560873 CCTAATAGGCAGAGTGTGCTAGG + Intergenic
1033451867 7:141469076-141469098 GCCAATAGGAAGAGGCTGCCTGG - Intronic
1035179427 7:157078372-157078394 GCAGACAGGCAGAGCGCGCCCGG - Intergenic
1035354778 7:158270505-158270527 GGTCATAGGCAGAGGGAGCCAGG - Intronic
1035379895 7:158431171-158431193 GCTGTGAGGCAGTGTGTGCCTGG - Intronic
1035616049 8:1002757-1002779 GCTGACAGGAAGAGACTGCCTGG + Intergenic
1038280674 8:26161405-26161427 GGAGAGAGGCAGAAGGTGCCAGG - Intergenic
1038676944 8:29631464-29631486 GCTGAGAGGCCGAGGGAGGCAGG + Intergenic
1040797222 8:51299572-51299594 GCTCATAGGCAGAAGGTGAGAGG - Intergenic
1041558116 8:59182733-59182755 GCTAAGAGGCAGAAGCTGCCAGG + Intergenic
1045337978 8:101225249-101225271 GTTGAAAGGAAGAGTGTGCCAGG + Intergenic
1046255666 8:111693918-111693940 GGTGACAAGCAGAGGGTTCCAGG + Intergenic
1049097789 8:140558948-140558970 GCTGATGGGCAGAAGGACCCCGG + Intronic
1049194274 8:141307264-141307286 GCTGAGACGCAGAAGGTGCGGGG + Intronic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1049540851 8:143208138-143208160 CCTGATGTGCAGAGGCTGCCAGG + Intergenic
1049600833 8:143506839-143506861 GCTGCTAGCCAGAGGTTTCCAGG - Intronic
1049999078 9:1056966-1056988 TCTAAGTGGCAGAGGGTGCCTGG - Exonic
1050094443 9:2048802-2048824 GCTGATAGGCAGATTCTGCTGGG + Intronic
1050575007 9:6985764-6985786 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1053667094 9:40324158-40324180 TCTGAGAGGCAGGTGGTGCCAGG - Intronic
1053780535 9:41601813-41601835 GGTGATGAGCAGAGGGTGTCAGG - Intergenic
1053916684 9:42949269-42949291 TCTGAGAGGCAGGTGGTGCCAGG - Intergenic
1054168478 9:61811970-61811992 GGTGATGAGCAGAGGGTGTCAGG - Intergenic
1054517516 9:66052125-66052147 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
1054669051 9:67768848-67768870 GGTGATGAGCAGAGGGTGTCAGG + Intergenic
1057644277 9:96858546-96858568 GCTGGTAGGCAGGGTGAGCCAGG + Intronic
1059188199 9:112296662-112296684 ACAGATAGGCAGTGGGTCCCTGG - Intronic
1060278169 9:122197939-122197961 GCTGCTTGCCAGAGTGTGCCAGG + Intronic
1060406340 9:123374873-123374895 GCTGCTGGGCAGTGGTTGCCTGG + Intronic
1060908761 9:127331928-127331950 GTTGATTGGAAGATGGTGCCAGG + Intronic
1061190602 9:129080690-129080712 GCGGATCGGCAGGGGGTACCAGG + Intergenic
1061395784 9:130342715-130342737 GCTGATGGGCACAGGGGGGCAGG - Intronic
1061551026 9:131334819-131334841 GGTGGGAGGGAGAGGGTGCCTGG + Intergenic
1061621573 9:131814340-131814362 GCTGTTAGGTGGAGGGTGCTGGG + Intergenic
1062004102 9:134230688-134230710 CCAGATCGACAGAGGGTGCCGGG + Intergenic
1062161709 9:135083956-135083978 GCTGCCAGGCACAGGGAGCCGGG + Intronic
1062167846 9:135117101-135117123 GCAGTTAGGCAGAGGGAGTCTGG - Intronic
1062367106 9:136215956-136215978 GCTGAGAAGCAGACGGTGCCGGG - Intronic
1062458695 9:136653789-136653811 GCTGGCAGGGAGTGGGTGCCCGG + Intergenic
1185513015 X:677207-677229 GCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1187972382 X:24671849-24671871 TCTCTTGGGCAGAGGGTGCCCGG - Intronic
1190190049 X:48269448-48269470 CCTGGTAGGCAGAGGTTGCAGGG - Intronic
1190502843 X:51096614-51096636 GGTGAGAAGCAGAGGGTGCCAGG + Intergenic
1195711493 X:107776471-107776493 GCAGAGAGTCAGAGAGTGCCAGG + Intronic
1197451788 X:126628687-126628709 GCTTATAGGCAGTGGGTACTTGG - Intergenic
1200244818 X:154517309-154517331 TCTCATGGGCAGAGGGAGCCCGG - Intergenic