ID: 1166112400

View in Genome Browser
Species Human (GRCh38)
Location 19:40630666-40630688
Sequence GCGGCAGTCCTGACAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166112390_1166112400 24 Left 1166112390 19:40630619-40630641 CCAGACCTGACGCTCCAGCTAGG No data
Right 1166112400 19:40630666-40630688 GCGGCAGTCCTGACAGCTGGAGG No data
1166112388_1166112400 30 Left 1166112388 19:40630613-40630635 CCAAACCCAGACCTGACGCTCCA No data
Right 1166112400 19:40630666-40630688 GCGGCAGTCCTGACAGCTGGAGG No data
1166112392_1166112400 19 Left 1166112392 19:40630624-40630646 CCTGACGCTCCAGCTAGGAGTTG No data
Right 1166112400 19:40630666-40630688 GCGGCAGTCCTGACAGCTGGAGG No data
1166112389_1166112400 25 Left 1166112389 19:40630618-40630640 CCCAGACCTGACGCTCCAGCTAG No data
Right 1166112400 19:40630666-40630688 GCGGCAGTCCTGACAGCTGGAGG No data
1166112395_1166112400 10 Left 1166112395 19:40630633-40630655 CCAGCTAGGAGTTGGCTGTGGAT No data
Right 1166112400 19:40630666-40630688 GCGGCAGTCCTGACAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166112400 Original CRISPR GCGGCAGTCCTGACAGCTGG AGG Intergenic
No off target data available for this crispr