ID: 1166112402 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:40630670-40630692 |
Sequence | CAGTCCTGACAGCTGGAGGC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1166112390_1166112402 | 28 | Left | 1166112390 | 19:40630619-40630641 | CCAGACCTGACGCTCCAGCTAGG | No data | ||
Right | 1166112402 | 19:40630670-40630692 | CAGTCCTGACAGCTGGAGGCGGG | No data | ||||
1166112395_1166112402 | 14 | Left | 1166112395 | 19:40630633-40630655 | CCAGCTAGGAGTTGGCTGTGGAT | No data | ||
Right | 1166112402 | 19:40630670-40630692 | CAGTCCTGACAGCTGGAGGCGGG | No data | ||||
1166112392_1166112402 | 23 | Left | 1166112392 | 19:40630624-40630646 | CCTGACGCTCCAGCTAGGAGTTG | No data | ||
Right | 1166112402 | 19:40630670-40630692 | CAGTCCTGACAGCTGGAGGCGGG | No data | ||||
1166112389_1166112402 | 29 | Left | 1166112389 | 19:40630618-40630640 | CCCAGACCTGACGCTCCAGCTAG | No data | ||
Right | 1166112402 | 19:40630670-40630692 | CAGTCCTGACAGCTGGAGGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1166112402 | Original CRISPR | CAGTCCTGACAGCTGGAGGC GGG | Intergenic | ||
No off target data available for this crispr |