ID: 1166112402

View in Genome Browser
Species Human (GRCh38)
Location 19:40630670-40630692
Sequence CAGTCCTGACAGCTGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166112390_1166112402 28 Left 1166112390 19:40630619-40630641 CCAGACCTGACGCTCCAGCTAGG No data
Right 1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG No data
1166112395_1166112402 14 Left 1166112395 19:40630633-40630655 CCAGCTAGGAGTTGGCTGTGGAT No data
Right 1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG No data
1166112392_1166112402 23 Left 1166112392 19:40630624-40630646 CCTGACGCTCCAGCTAGGAGTTG No data
Right 1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG No data
1166112389_1166112402 29 Left 1166112389 19:40630618-40630640 CCCAGACCTGACGCTCCAGCTAG No data
Right 1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166112402 Original CRISPR CAGTCCTGACAGCTGGAGGC GGG Intergenic
No off target data available for this crispr