ID: 1166114165

View in Genome Browser
Species Human (GRCh38)
Location 19:40642543-40642565
Sequence CTGTAAATAAAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166114161_1166114165 5 Left 1166114161 19:40642515-40642537 CCTGGGTTGGGATGACTCGGCCT No data
Right 1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166114165 Original CRISPR CTGTAAATAAAGAAGGAAGA GGG Intergenic
No off target data available for this crispr