ID: 1166117842

View in Genome Browser
Species Human (GRCh38)
Location 19:40666903-40666925
Sequence CCTTGGGCCAAGGTCTCATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166117842_1166117851 -1 Left 1166117842 19:40666903-40666925 CCCCATGAGACCTTGGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1166117851 19:40666925-40666947 GAAGACATGGGCCCCAAAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 164
1166117842_1166117852 2 Left 1166117842 19:40666903-40666925 CCCCATGAGACCTTGGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1166117852 19:40666928-40666950 GACATGGGCCCCAAAGTTGGAGG 0: 1
1: 0
2: 0
3: 16
4: 146
1166117842_1166117853 3 Left 1166117842 19:40666903-40666925 CCCCATGAGACCTTGGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1166117853 19:40666929-40666951 ACATGGGCCCCAAAGTTGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 131
1166117842_1166117854 9 Left 1166117842 19:40666903-40666925 CCCCATGAGACCTTGGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1166117854 19:40666935-40666957 GCCCCAAAGTTGGAGGGTGATGG 0: 1
1: 0
2: 3
3: 16
4: 197
1166117842_1166117859 27 Left 1166117842 19:40666903-40666925 CCCCATGAGACCTTGGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1166117859 19:40666953-40666975 GATGGAGGTGAGTACAGCATTGG 0: 1
1: 0
2: 1
3: 24
4: 262
1166117842_1166117858 12 Left 1166117842 19:40666903-40666925 CCCCATGAGACCTTGGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1166117858 19:40666938-40666960 CCAAAGTTGGAGGGTGATGGAGG 0: 1
1: 2
2: 1
3: 22
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166117842 Original CRISPR CCTTGGGCCAAGGTCTCATG GGG (reversed) Exonic
900338809 1:2178057-2178079 CCTTCTGCCAAGGTCACATGGGG - Intronic
900540737 1:3201495-3201517 GCAAGGGCCCAGGTCTCATGAGG - Intronic
901405275 1:9040929-9040951 GACTGGTCCAAGGTCTCATGAGG - Intronic
907320581 1:53599706-53599728 CTGTGGGCCATGGTCTCCTGGGG + Intronic
908011784 1:59785902-59785924 CCATGGTCCAAAGTCTCATCTGG + Intergenic
912498417 1:110106223-110106245 CCTGGGCACAAGGTCTCACGTGG - Intergenic
917262108 1:173181552-173181574 TCTGGTGCCATGGTCTCATGGGG - Intergenic
919658968 1:200224459-200224481 CCTGGGGCCAAGTTTTCACGCGG - Intergenic
919849796 1:201664911-201664933 CCTTGGGCCCAGGTGTCCTTGGG + Intronic
924920369 1:248622868-248622890 CCCTGGGCAAAGCTCTCATCAGG - Intergenic
1064103583 10:12483216-12483238 CTTTGAGACAAGGTCTCATTTGG + Intronic
1065149456 10:22807382-22807404 CCTTGGGCTAAGGACTGAAGTGG - Intergenic
1065172246 10:23043102-23043124 CCTTGCTCCCAAGTCTCATGGGG + Intergenic
1065926091 10:30434566-30434588 CCTTGCGCAAGGGTCTCACGGGG + Intronic
1067511503 10:46898674-46898696 CTTTGGACCAAGGTCACCTGAGG - Intergenic
1067650743 10:48153191-48153213 CTTTGGACCAAGGTCACCTGAGG + Intergenic
1068463017 10:57351441-57351463 CCTTGGGCTAAAGTGTCTTGTGG + Intergenic
1069637159 10:69931876-69931898 CCTCTGCCCATGGTCTCATGAGG + Intronic
1070824682 10:79384319-79384341 CCTTGGGCCAAGGTCCCCCATGG + Exonic
1072210056 10:93238321-93238343 CCTTGGGCCAAACTCCCCTGAGG + Intergenic
1073038065 10:100578218-100578240 CCCTGGGGCTAGGGCTCATGGGG + Intergenic
1078146465 11:8724972-8724994 CCTTGTGCCTAAGTCCCATGGGG - Intronic
1079003957 11:16779634-16779656 CCTTGGGCCAGGCTCTGAGGAGG - Intronic
1079681686 11:23304901-23304923 CCTAGGCCCAAGGTCAAATGGGG - Intergenic
1083535583 11:63463994-63464016 GCTTGGGCCTAGGAGTCATGAGG - Intronic
1083669241 11:64291295-64291317 CCTTGGGCTCAGCACTCATGAGG - Intronic
1084076522 11:66782396-66782418 ACCTTGGCCAAGGACTCATGGGG + Intronic
1089176037 11:116549517-116549539 TCCTGGGCTAAGGTCTCATCTGG + Intergenic
1089601296 11:119616921-119616943 CCGTGAGCCATGGTCTCAGGAGG - Intergenic
1089623633 11:119737516-119737538 CCTGGGACCAAAGTCTAATGGGG + Intergenic
1091016993 11:132060080-132060102 CCTGGGGCCTATGTCTCATGTGG - Intronic
1091840572 12:3617523-3617545 CCTTGGGGACAGGTGTCATGAGG + Intronic
1093464712 12:19437992-19438014 CCTTGGGTCAGGGTGTAATGTGG + Intronic
1097836716 12:64280845-64280867 CCTTTGCCCAGGGTCTCACGAGG - Intronic
1098148207 12:67519302-67519324 CCTTGGACCATGATCTCACGTGG + Intergenic
1100204763 12:92336813-92336835 CCTTGGGCCATGTTCCCATCTGG - Intergenic
1100972242 12:100082447-100082469 GCCTCGGCCAAGATCTCATGAGG - Intronic
1102600438 12:114025649-114025671 TCTTGAACCAGGGTCTCATGAGG - Intergenic
1103607466 12:122097855-122097877 CCTTCTGCCAAGGTTTCTTGTGG - Intronic
1103727728 12:123006788-123006810 CCTTGGGCCAGGGTGGGATGGGG + Intronic
1104343449 12:127973606-127973628 CCTTGGCCCACGTTCTTATGGGG - Intergenic
1104372197 12:128233833-128233855 CCTTGGCTCATGGTCACATGTGG + Intergenic
1107260694 13:38487336-38487358 CCTCTGCCCAGGGTCTCATGAGG + Intergenic
1108683258 13:52797592-52797614 CGTTTGGCCAGGGTGTCATGGGG - Intergenic
1114168275 14:20244405-20244427 ACTAGAGCCAAGGGCTCATGTGG - Intergenic
1114466394 14:22925916-22925938 CCTTCTGCAAAGTTCTCATGAGG + Intronic
1115942677 14:38627178-38627200 CCTAGGGCTAAGGTCTCCTATGG - Intergenic
1116866891 14:50038560-50038582 CCTTACCCCAAGGCCTCATGGGG - Intergenic
1118416058 14:65538077-65538099 CCTAGGGCCAAAGTCTCCTATGG + Intronic
1119704866 14:76777172-76777194 CCCTAGGCCAAGATCTCCTGGGG + Intronic
1122236394 14:100332865-100332887 CCTGGGGCCAGGGTCTCACCAGG + Intergenic
1122569249 14:102683632-102683654 CTTTGGGCCAAGCTCTCCTCTGG + Intronic
1122716827 14:103701040-103701062 CCTGGGGCCGAGGGGTCATGGGG - Intronic
1122828597 14:104384213-104384235 TCTGGGGCCAAGGCTTCATGGGG - Intergenic
1124507864 15:30294475-30294497 TCCTGGCCCAAGGTCTCAGGTGG - Intergenic
1124735691 15:32244182-32244204 TCCTGGCCCAAGGTCTCAGGTGG + Intergenic
1126419423 15:48455625-48455647 ACTTGGGCCAAGGTCTGAACTGG + Intronic
1129191683 15:73941334-73941356 CCTGGGGCCTGGGCCTCATGGGG - Intronic
1130306349 15:82714390-82714412 CTTTGAGTCAAGGTCTGATGAGG + Intergenic
1132510868 16:340725-340747 TCCTGGGCCAAGGTTTCATGGGG - Intronic
1133318847 16:4900796-4900818 CCTGGGGGAAAGGCCTCATGGGG - Intronic
1136487603 16:30583288-30583310 CCTTGAGCCAGGGATTCATGGGG + Exonic
1137727994 16:50669972-50669994 CCAGGGGACAGGGTCTCATGAGG + Intronic
1138198702 16:55073426-55073448 CCTGGGCTCAGGGTCTCATGAGG - Intergenic
1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG + Intronic
1144890586 17:18491821-18491843 CCAAGGGCCAAAGGCTCATGAGG + Intronic
1145141632 17:20452497-20452519 CCAAGGGCCAAAGGCTCATGAGG - Intronic
1145809075 17:27753960-27753982 CCAAGGGCCAAAGGCTCATGAGG + Intergenic
1145944316 17:28761499-28761521 CTTTGGGCCAAGGCCACCTGAGG - Intronic
1146039620 17:29438597-29438619 CCTTGGGCCCAGAGCTCAGGAGG + Intronic
1146108848 17:30068745-30068767 CCTTGGGCCAGGGACTCCTGCGG - Intronic
1152943117 17:83182823-83182845 CCTTGGGCCAGGGTAGCCTGTGG + Intergenic
1156360911 18:36383793-36383815 CACTTGGCCAAGGTCCCATGAGG + Intronic
1157329960 18:46696476-46696498 CCTTGGTCCAGGGTGTGATGAGG - Intronic
1157626765 18:49057344-49057366 CCTTGAGCCCAGGTCTCTCGTGG + Intronic
1160227472 18:77022153-77022175 CCTTGGAACCAGGTCTTATGTGG - Intronic
1161314206 19:3610344-3610366 CCTGGGCCCAGGCTCTCATGGGG - Intergenic
1162589183 19:11579273-11579295 CCTGGGGCCAAGCTCTTGTGAGG + Intronic
1163186740 19:15644275-15644297 CCTTGGGTTGAGGTCTCTTGGGG - Intronic
1163230517 19:15998645-15998667 CCTTGGGTTGAGGCCTCATGGGG + Intergenic
1165327172 19:35120971-35120993 CCTTGGGAAAGGGTCTCCTGCGG - Intronic
1165752771 19:38270907-38270929 CGGTGGGCCAAGGCCTCCTGGGG - Intronic
1166117842 19:40666903-40666925 CCTTGGGCCAAGGTCTCATGGGG - Exonic
1166141217 19:40806430-40806452 CCTTGACCCAAGGAGTCATGGGG + Intronic
1167416348 19:49375060-49375082 GCTTGGGGCAGGGTCTGATGGGG - Exonic
1167794118 19:51698157-51698179 CACTTGGCCAAGGTCGCATGGGG + Intergenic
927862623 2:26569686-26569708 CCCTGGGCAATGGTCACATGTGG - Intronic
929806936 2:45154256-45154278 CCTTGGACCACACTCTCATGGGG + Intergenic
930949803 2:57126795-57126817 GTTTGGGCCATAGTCTCATGTGG + Intergenic
932788623 2:74632390-74632412 CCTTGGGCCAAGTCCTCCTCAGG + Intronic
935655561 2:105419980-105420002 GCATTGGCCAAGGTCTCAAGAGG + Intronic
936632117 2:114214892-114214914 CCCTGCCCCAAGGTCTCATATGG - Intergenic
937530492 2:122821572-122821594 CCTTGTACCAAGGTCTCTTGTGG + Intergenic
940194572 2:151079677-151079699 ACTGGGTCCAAAGTCTCATGTGG + Intergenic
941745468 2:169082101-169082123 CCTTGGGCCTAAGTCTCAGTGGG + Intronic
947044141 2:225959297-225959319 CTTTCGGTCAAGGACTCATGGGG + Intergenic
948781755 2:240325796-240325818 CCTTGTGCCAAGGACTGTTGTGG - Intergenic
1168840967 20:909945-909967 CCTTGGGCCAAGGGTTCCTGGGG + Intronic
1169940945 20:10936653-10936675 CCTCTGGTCAAGGTCTCATCAGG + Intergenic
1171167187 20:22982178-22982200 CCTTGGCCCAAGGGCTATTGTGG + Intergenic
1171936606 20:31280175-31280197 CCTAGGGCTAAAGTCTCATATGG - Intergenic
1174160676 20:48548168-48548190 CCTTGGGCCCATGGCTCATGGGG - Intergenic
1175903754 20:62370002-62370024 CCCTGGGACAAGGTCTGCTGCGG + Intergenic
1179033555 21:37741026-37741048 TCTTGGGGAAAGGTCTCCTGTGG + Intronic
1179548561 21:42128009-42128031 CCTTGGACGGAGGACTCATGTGG + Intronic
1180089204 21:45525166-45525188 CCTGGGGCCCAGGTCTCACTGGG - Intronic
1180192575 21:46173121-46173143 CCTAGGTCCAAAGTCTCCTGTGG - Intronic
1181101811 22:20545757-20545779 GCTGGGGCCAAGGTCCCATGGGG + Intronic
1181577299 22:23803112-23803134 CCCGGGGCCACGGTCTAATGGGG - Intronic
1181983041 22:26779819-26779841 TCTTGAGCCTAGGTCTCAGGAGG + Intergenic
1183213777 22:36466494-36466516 CCTAGGGCCAAGCTGTCATTAGG - Intergenic
1203245151 22_KI270733v1_random:60711-60733 CCTAGGGCTAACGTCTCTTGTGG + Intergenic
950774453 3:15337610-15337632 CCTGGGGCCCAGGTTTCATGAGG - Intronic
954223372 3:49167742-49167764 CCAGGGGCCAGGATCTCATGGGG + Intergenic
960012507 3:112849149-112849171 CCTAGGGACAAAGTCTCCTGTGG - Intergenic
960609143 3:119539029-119539051 GCTTTGCCCATGGTCTCATGAGG - Intronic
960799097 3:121520025-121520047 CCTTTCGTCAAGGTCTCATTCGG - Exonic
962655794 3:137542822-137542844 CCTTGGACTAAGGTCTCCTAGGG + Intergenic
962739680 3:138354048-138354070 CAGTGGGCAAAGGCCTCATGAGG + Intronic
964737823 3:159934331-159934353 GCTTGGGCCATGGTTTCATAGGG - Intergenic
966639345 3:182172495-182172517 CCTTGGGCTAAGGTAGCATGGGG - Intergenic
967587960 3:191237531-191237553 CCTAAGGCCAAGGTCAAATGGGG - Intronic
967877695 3:194277954-194277976 CCTGAGGTCAAGGCCTCATGGGG - Intergenic
968227019 3:196979152-196979174 CCTTGGCCCCAGGTCTCCAGTGG - Intergenic
968558385 4:1261923-1261945 CCTTGGGCGCAGGTCTGAGGAGG + Intergenic
978136318 4:105265588-105265610 CCTTTGGCCAAAGTTTTATGAGG + Intronic
983793191 4:171824899-171824921 ACTTGAACCAAGGTCTCATGTGG + Intronic
985592237 5:771445-771467 CATGGGGGCAGGGTCTCATGGGG + Intergenic
986785190 5:11107817-11107839 CCTTGGGGCAAAGTCTCACCAGG + Intronic
986892025 5:12320635-12320657 CCTAGGGCTAAAGTCTCCTGTGG + Intergenic
991903363 5:71482155-71482177 ACTTAGGCCAAGGTATCATGGGG + Intronic
993795908 5:92267844-92267866 CCTAGAGCTAAGGTCTCCTGTGG - Intergenic
994151829 5:96456686-96456708 CCTTGGGCTTCTGTCTCATGAGG + Intergenic
997445041 5:133934412-133934434 CCTTGCGCCAGGGTGTCCTGAGG - Intergenic
999133042 5:149299261-149299283 CCTTGGGCCAAGGCCATCTGAGG + Intronic
1002254128 5:177946023-177946045 CCTAGAGCCAAGGTCCCCTGGGG - Intergenic
1003321948 6:5059596-5059618 CCTGGGGACAAAGTCTGATGGGG - Intergenic
1004579470 6:16934940-16934962 TCTTGGGCCAAGGTGTCCAGTGG + Intergenic
1004806171 6:19205756-19205778 CCTAGGGCTAAAGTCTCCTGTGG + Intergenic
1006212859 6:32412090-32412112 CTCTGGGCCAAGGTCCCTTGTGG + Intergenic
1006260583 6:32865895-32865917 CCTTTCGCCAAGGTAACATGTGG + Intergenic
1006672306 6:35737065-35737087 CCTTGGGCCTAGCTCTCACCTGG + Exonic
1018580946 6:165308082-165308104 CCTTGGGCTCAGGTCCCCTGTGG - Intronic
1020109287 7:5439297-5439319 CCTAGAGACAAGGTCTCAAGAGG - Intronic
1021572306 7:22078469-22078491 CCTGGAGCCAAGGCTTCATGGGG + Intergenic
1026891582 7:73985756-73985778 CCTTGGGCCAAGGACCCCAGAGG - Intergenic
1034106113 7:148491263-148491285 CTTTGCCCCCAGGTCTCATGGGG - Intergenic
1035225151 7:157428608-157428630 CCTTGGGCCAGAGTCTGCTGGGG + Intergenic
1035582682 8:749810-749832 CCTGGAGCCAAGGTATCCTGGGG + Intergenic
1037323378 8:17664798-17664820 CCTTAAGCCAAGGTCTGATCTGG + Intronic
1039866582 8:41509930-41509952 CCTTGGGCCAGCTTCTCAGGTGG + Exonic
1042988544 8:74612103-74612125 CTTTTGCCCAAGGTGTCATGCGG - Intronic
1049404384 8:142445217-142445239 CCTAGGGCTGAGGTCGCATGGGG - Intergenic
1051852801 9:21528503-21528525 CCTAGGGCTAAGGTCTCCTATGG + Intergenic
1052723448 9:32200952-32200974 CCTTGGGTCCAGTTCTCATATGG + Intergenic
1056750665 9:89348733-89348755 CCATGGGGCAGGGTCTCCTGGGG - Intronic
1057108551 9:92444999-92445021 CCTAGGGCCAACGTCTCCTATGG + Intronic
1057800108 9:98185797-98185819 CCTTGGGCCAGGGTCTCTCCTGG - Intronic
1058056891 9:100457719-100457741 GCTGGGGCAAATGTCTCATGTGG + Intronic
1058776915 9:108293565-108293587 CCTTGAGCCAGAGTCTCAGGAGG - Intergenic
1186685740 X:11922819-11922841 CCTAGGGCTAAGGTCTCTTATGG - Intergenic
1187038827 X:15571544-15571566 CCTTTGGCCCCAGTCTCATGAGG - Intronic
1188645109 X:32555904-32555926 GCATGGGCAAAGGTTTCATGAGG + Intronic
1189755853 X:44270733-44270755 TCTTGGGCAGAGGTCACATGGGG - Intronic
1189940203 X:46113147-46113169 CCTGGTGGCATGGTCTCATGGGG + Intergenic
1190907996 X:54747012-54747034 CCTTGGGCCAAAGTGTTTTGGGG - Intergenic
1191885849 X:65887193-65887215 CCTTGGGCCAAACTCTCTTTAGG - Intergenic
1193452895 X:81692521-81692543 GCATGGGCAAAGGTTTCATGAGG - Intergenic
1198334060 X:135650211-135650233 CCTAGGGCCTCGGTCTCATGGGG + Intergenic
1198528352 X:137524665-137524687 TCTTAGGCCACAGTCTCATGGGG - Intergenic