ID: 1166118855

View in Genome Browser
Species Human (GRCh38)
Location 19:40672921-40672943
Sequence GTCTACTCCTGAGCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166118854_1166118855 -9 Left 1166118854 19:40672907-40672929 CCTGTAGTGCTTCAGTCTACTCC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1166118855 19:40672921-40672943 GTCTACTCCTGAGCAAAAACAGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166118855 Original CRISPR GTCTACTCCTGAGCAAAAAC AGG Intronic
901536743 1:9887370-9887392 GTCAACTCCTGAGCCAGAAGGGG - Intronic
904413134 1:30337057-30337079 GTCTGCTAGTCAGCAAAAACAGG + Intergenic
909615016 1:77598057-77598079 GTCGACCCTTGAGCAACAACAGG + Intronic
914342799 1:146774631-146774653 GTCTCATCCTGAGAAAAATCTGG + Intergenic
1064140870 10:12789039-12789061 ATATATTCCTGAGCAAGAACAGG - Intronic
1067339180 10:45387409-45387431 TTCTTATACTGAGCAAAAACGGG - Intronic
1068414660 10:56703657-56703679 GAATACTCCTGAGCAGTAACAGG + Intergenic
1070575212 10:77672382-77672404 ATCTACTCCTGAGCCTACACTGG - Intergenic
1071969874 10:90893302-90893324 GTTTACTCCTGAGCATTTACGGG - Intronic
1078995945 11:16699951-16699973 TTATACTGGTGAGCAAAAACAGG + Intronic
1081729434 11:45359273-45359295 GTCTAATCATGAGAAAATACTGG - Intergenic
1091622656 12:2101065-2101087 GTCTAATATTAAGCAAAAACAGG - Intronic
1097690267 12:62728424-62728446 CTCTAGTCCTGAGCAGAAACTGG + Intronic
1097773252 12:63614967-63614989 GTGTACTCCTGCCCAAAACCTGG - Intronic
1097845829 12:64364413-64364435 CCCTACCCTTGAGCAAAAACAGG - Intronic
1101185036 12:102267172-102267194 CTCAAGTCCTGAGGAAAAACAGG - Intergenic
1106924395 13:34599026-34599048 GTCCACTCCAAAGCAAATACAGG + Intergenic
1107716720 13:43206634-43206656 GTCTAAGGCTGAGCAACAACAGG - Intergenic
1108641421 13:52385922-52385944 GTCTACTCCTGATCTTAGACTGG + Intronic
1110112577 13:71766405-71766427 GGCTACACCTTAGAAAAAACTGG - Intronic
1113037816 13:106070497-106070519 GTCTCCCTCGGAGCAAAAACAGG - Intergenic
1118036362 14:61872597-61872619 GTCTTCTCTTGAGAAGAAACAGG - Intergenic
1120557133 14:85942394-85942416 GTCTACTAATGAGCAATAAAAGG + Intergenic
1121209736 14:92199342-92199364 GTCTGCTCCTAAGCCAAAAAAGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1124605097 15:31163638-31163660 GTCTACACCTATGCAAAAAAGGG + Intergenic
1126156793 15:45573520-45573542 GTCTTCTCCTCAGCCAAAATAGG - Intergenic
1126360200 15:47837836-47837858 GTCCACTCCTGAGCAGAGACAGG - Intergenic
1127469699 15:59279569-59279591 GTCCCCTCCTCAGCAAAAAGGGG + Intronic
1130615064 15:85398498-85398520 ATGTACTCTTGAGCATAAACAGG + Intronic
1137016711 16:35384310-35384332 GTCTGCTCCTGGGCACAAAGAGG + Intergenic
1137298489 16:47121738-47121760 GTCTACCCCTGTGCAGTAACAGG + Intronic
1138248136 16:55482115-55482137 TGCTACTGCTGAGGAAAAACAGG - Intronic
1138271568 16:55699539-55699561 GTCCACTCCTGTGCACACACAGG - Exonic
1139111471 16:63896637-63896659 GGGTAATACTGAGCAAAAACAGG + Intergenic
1139991186 16:70940697-70940719 GTCTCATCCTGAGAAAAATCTGG - Intronic
1144285731 17:13772060-13772082 TTCTACTTCTAAGAAAAAACAGG + Intergenic
1148734769 17:49859149-49859171 GTCTCCATCTGTGCAAAAACAGG - Intergenic
1149148879 17:53534788-53534810 GTCAACTGCTGTTCAAAAACAGG - Intergenic
1150349944 17:64436469-64436491 GTCTGCTGCTCAGCAGAAACAGG + Intergenic
1151172315 17:72257359-72257381 GTTTACTCCTGAGCACTGACTGG - Intergenic
1152157817 17:78646334-78646356 GTCTACTCGTGGGGAAACACAGG + Intergenic
1153515710 18:5898981-5899003 GTCAACCCCAGATCAAAAACAGG + Intergenic
1155611475 18:27672482-27672504 GTCTAAGCATAAGCAAAAACAGG + Intergenic
1157816586 18:50733948-50733970 GTCTACTCATCAGCAAAATGAGG - Intergenic
1163709086 19:18834791-18834813 GCCAACTCCTGAGGACAAACAGG - Intronic
1164077296 19:21831908-21831930 TTCTATTCATGAGCATAAACGGG - Intronic
1166118855 19:40672921-40672943 GTCTACTCCTGAGCAAAAACAGG + Intronic
1166143819 19:40821078-40821100 AGCTACTCCTGAGGAGAAACAGG - Intronic
1167035684 19:46993888-46993910 GTCTACCCCTGACCACACACTGG + Intronic
1167833717 19:52048845-52048867 GTCTCCTCCTGAGGAAAAGCCGG - Intronic
925067391 2:939049-939071 GTGTACACCTGAGCATACACAGG - Intergenic
925399402 2:3561027-3561049 TTCTTATCCTGAGCAAACACTGG + Intergenic
925897076 2:8480854-8480876 GTCCACACCTGAGCAAAACTGGG - Intergenic
928226785 2:29456206-29456228 TTCTACTCCTGGGCATATACTGG + Intronic
930021194 2:47003236-47003258 GTCTAGCCATGAGCAAGAACTGG + Intronic
932805990 2:74783918-74783940 GACTGATCCTGAGCAAATACTGG + Intergenic
934657556 2:96123989-96124011 GACTGCTCCTGAGCAACACCGGG + Exonic
945809900 2:214536082-214536104 CTCTAATGGTGAGCAAAAACAGG - Intronic
945884270 2:215358462-215358484 GTTTACTCCTGATCTCAAACAGG - Intergenic
1170300774 20:14881887-14881909 GTCTACTCCTGAGAAATTAGGGG - Intronic
1172668308 20:36615909-36615931 TTCTACTCTTGAGCACAAACGGG - Intronic
1178889963 21:36513058-36513080 GTAGATTCCTGAGCAAAAATGGG - Intronic
1185169176 22:49282465-49282487 GTCTGCTCCTCTGCAGAAACCGG + Intergenic
952431904 3:33231947-33231969 GGCTGCTCCTGAGTAAACACAGG + Intergenic
956168590 3:66414970-66414992 CTCTTCGCCTGAGCAAAAACAGG - Exonic
960594189 3:119392936-119392958 GTTTACTCCTGTATAAAAACTGG + Intronic
960821361 3:121736458-121736480 GTCTAATCATGAGAAAACACTGG + Intronic
962718341 3:138148231-138148253 GGCTTCTACTGAACAAAAACAGG + Intergenic
963866664 3:150368955-150368977 GTCTACTCCTGATTAAGACCTGG - Intergenic
972778182 4:42262845-42262867 GACTACTCCATAGGAAAAACAGG + Intergenic
978347048 4:107782165-107782187 GTCTATTCCTAATCAATAACTGG + Intergenic
980436562 4:132783476-132783498 CTTTAGTCCTGAGCAAAATCAGG - Intergenic
982643740 4:157996161-157996183 GTCTACTCCAGAGCAAGGCCTGG - Intergenic
988805798 5:34739478-34739500 CTCTACTACTGAGAATAAACTGG - Intronic
989573140 5:42964095-42964117 TGCTACTCCTGAGCAGAGACTGG - Intergenic
990536610 5:56729694-56729716 GTTTCCTCATCAGCAAAAACTGG + Intergenic
992075591 5:73190079-73190101 GTCTAATCCTGCTGAAAAACTGG - Intergenic
993331654 5:86607620-86607642 GTCTACTCCTAAGGAAACGCTGG + Intergenic
998101344 5:139437907-139437929 ATCTACTCCTGACCACAAAGAGG + Intronic
999098984 5:149006653-149006675 GTCTACTCCTCAGCGAAGATGGG + Intronic
999567847 5:152885734-152885756 GTCTTCTCCTGAGCATCAAGTGG + Intergenic
1008596625 6:53048741-53048763 GTCGAATCCTGAGTAAAATCAGG - Intronic
1008624081 6:53300748-53300770 GTCTACTGCTGAGCAAGGCCTGG - Intronic
1012098560 6:94998982-94999004 GTCTGCTACTGAGGAACAACTGG - Intergenic
1015887839 6:137938227-137938249 GCATACTCCTGAGCAACAAATGG - Intergenic
1019326404 7:440469-440491 TCCTACTCCTGAGCAGTAACGGG + Intergenic
1020744621 7:12066401-12066423 GTCTAGTCCTTAGTAAAACCTGG - Intergenic
1022932819 7:35138697-35138719 GTGTACTCCTGCCCAAAACCTGG - Intergenic
1023155211 7:37244148-37244170 TTCTACTCCAAAGCAAAAAAAGG + Intronic
1024460963 7:49658923-49658945 GTCTACCCCTGAGCATAGCCAGG - Intergenic
1026613251 7:71879603-71879625 CTCTAAGCCTGAGAAAAAACTGG - Intronic
1026672313 7:72401064-72401086 GTTGACACCTTAGCAAAAACGGG - Intronic
1029828737 7:103231461-103231483 GTGTACTCCTGCCCAAAACCTGG - Intergenic
1036644912 8:10607035-10607057 TTCTACTTCTGAGCAAGAAGAGG - Exonic
1037347155 8:17912895-17912917 GCCGCCTCCTCAGCAAAAACTGG - Intergenic
1039654819 8:39392152-39392174 GGCTGCTCCTGAGAAACAACTGG + Intergenic
1046598182 8:116286094-116286116 GTCTCCTCGTGTGCAAAAAAAGG - Intergenic
1052332123 9:27280917-27280939 GGCTCCTGCTGATCAAAAACAGG + Intergenic
1057108980 9:92448780-92448802 GTCTACACCTTAGCAGAATCGGG + Intronic
1058270941 9:102970943-102970965 GTCTAATCCTGCCCAAGAACAGG - Intergenic
1061835740 9:133328359-133328381 GTCTCGTCCTGAGCAGAGACAGG - Intergenic
1185781535 X:2851560-2851582 GTCTAATCATGAGAAAACACTGG - Intronic
1185803916 X:3039577-3039599 GTCTAATCATGAGAAAACACTGG - Intergenic
1186308990 X:8296927-8296949 GTATACTCCTAAGCAGAAAGGGG + Intergenic
1186722898 X:12324849-12324871 GACTTCTACTGAGCAAAAGCTGG + Intronic
1194680785 X:96849664-96849686 TTCTACTCCTGACAAAAGACAGG - Intronic
1195268712 X:103210444-103210466 GTCCACTGCAGAGAAAAAACAGG - Intergenic
1195732843 X:107982761-107982783 GTTTAGTCCTGAGCAAACAGGGG - Intergenic
1198073219 X:133169987-133170009 GTCTACACCTTAGCAGAATCAGG - Intergenic
1199530197 X:148838115-148838137 GTCTGCTTGTGAGCAAGAACTGG - Intronic
1199978744 X:152909317-152909339 GTCCACACCTGAGCCATAACCGG + Intergenic
1201276805 Y:12306361-12306383 GTCTAATCATGAGAAAACACTGG + Intergenic