ID: 1166122667

View in Genome Browser
Species Human (GRCh38)
Location 19:40694770-40694792
Sequence CATTGAGACCTGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166122667_1166122683 29 Left 1166122667 19:40694770-40694792 CCCTCATCCCTCAGGTCTCAATG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1166122683 19:40694822-40694844 TTGGCTCCCCAGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 31
4: 265
1166122667_1166122678 19 Left 1166122667 19:40694770-40694792 CCCTCATCCCTCAGGTCTCAATG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1166122678 19:40694812-40694834 GAAGCCCTCCTTGGCTCCCCAGG 0: 1
1: 0
2: 3
3: 46
4: 312
1166122667_1166122671 -4 Left 1166122667 19:40694770-40694792 CCCTCATCCCTCAGGTCTCAATG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1166122671 19:40694789-40694811 AATGCTGACACTCCCTCCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 180
1166122667_1166122680 23 Left 1166122667 19:40694770-40694792 CCCTCATCCCTCAGGTCTCAATG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1166122680 19:40694816-40694838 CCCTCCTTGGCTCCCCAGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 445
1166122667_1166122672 -3 Left 1166122667 19:40694770-40694792 CCCTCATCCCTCAGGTCTCAATG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1166122672 19:40694790-40694812 ATGCTGACACTCCCTCCTCCGGG 0: 1
1: 0
2: 3
3: 14
4: 286
1166122667_1166122675 10 Left 1166122667 19:40694770-40694792 CCCTCATCCCTCAGGTCTCAATG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1166122675 19:40694803-40694825 CTCCTCCGGGAAGCCCTCCTTGG 0: 1
1: 5
2: 54
3: 174
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166122667 Original CRISPR CATTGAGACCTGAGGGATGA GGG (reversed) Intronic
900252391 1:1677963-1677985 GATTGAGACCTGGGGGAGGTGGG - Intronic
902124746 1:14199384-14199406 AACTGAGACCTGAGGAGTGATGG - Intergenic
903535683 1:24064737-24064759 TATTGAGAGATGAGGGCTGAAGG - Intronic
904187444 1:28716429-28716451 CATTAAGAGTTGAGGGATGGAGG - Intronic
904568890 1:31445733-31445755 CATTGAGACCAGAGGGAAAGAGG - Intergenic
905244222 1:36601694-36601716 GATTGAGAACATAGGGATGAGGG + Intergenic
906084448 1:43119494-43119516 CTTTGAGAGCTGAGAGAAGAAGG - Intergenic
907909221 1:58812538-58812560 CATTTAAAGCTGAGGGCTGAAGG + Intergenic
909519074 1:76546547-76546569 CTTTGAGACATGAGGTATGTAGG + Intronic
910505255 1:87943195-87943217 CAGTGAAACCTAAAGGATGAGGG + Intergenic
912942134 1:114054609-114054631 CTTTCAGTCCTGAGGGATAATGG - Intergenic
915459501 1:156061309-156061331 TTTTGAGAGCTGAGGGTTGAGGG + Exonic
915811861 1:158921296-158921318 AAATGAGAGCTGAGGGAAGAAGG - Intergenic
917318604 1:173755699-173755721 CAGTGAGACATGAGTCATGATGG + Intronic
918546860 1:185694407-185694429 CAATCAGAGCTGAGGAATGAGGG + Intergenic
920067078 1:203276683-203276705 CCTGGAGACCTGAGGGACCAAGG + Intergenic
921070821 1:211656255-211656277 CTTTGAAACCTGAGGCATGCTGG - Intergenic
1063102278 10:2961191-2961213 CTTTGAGATTTGAAGGATGATGG - Intergenic
1064719699 10:18216658-18216680 CATTGAGACTGGAGAGAGGAAGG + Intronic
1065570258 10:27063745-27063767 CATTAAGACCTGAGGGAGCCAGG - Intronic
1068429985 10:56919269-56919291 AATGGAAACCTGAGGGAAGAAGG - Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1071450116 10:85786162-85786184 CAGTGAGACCTGATTCATGAAGG + Intronic
1074181409 10:111068109-111068131 GCTTGAGACCTCAGGAATGAGGG - Intergenic
1074840295 10:117344725-117344747 AAATGAGAGCTGTGGGATGAGGG - Intronic
1075661796 10:124202230-124202252 AATTGAGTCCTGATGGAGGAAGG - Intergenic
1076586527 10:131552210-131552232 CATGGAGACCTGAGGGGCCATGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077383872 11:2259967-2259989 CATGGAGGGCTGAGGGGTGAGGG + Intergenic
1078269052 11:9777650-9777672 AGTTAAGACCTGAGGAATGAAGG + Intergenic
1078396698 11:10987762-10987784 AAATGAGGCCAGAGGGATGAAGG - Intergenic
1079699906 11:23532365-23532387 CCTGGAGACCAGTGGGATGAGGG - Intergenic
1080746378 11:35111866-35111888 CTCTGAGACCTGTGGGATGTGGG - Intergenic
1081754529 11:45535182-45535204 CATTGAGACCTGGCAGCTGAGGG - Intergenic
1082183092 11:49144226-49144248 AGCTGAGACCTGAAGGATGAGGG + Intergenic
1082222107 11:49651448-49651470 TATTGAGAATTGAGTGATGAGGG - Intergenic
1084594134 11:70107127-70107149 CGATTAGATCTGAGGGATGATGG + Intronic
1085318619 11:75561380-75561402 CAGTGAGACCTGAGGCCTGTGGG + Intergenic
1088319354 11:108539315-108539337 CATGAAGACCTCAGGGATTAAGG + Intronic
1091461578 12:647150-647172 CACAGACACCTGAGGGATGGGGG - Intronic
1092265983 12:6980888-6980910 CATAGAGACCTGAGTCATGCAGG - Intronic
1093962496 12:25290369-25290391 CATGGAGACGTGAAGGATGTGGG + Intergenic
1096666520 12:53169969-53169991 CATGGAGACGAGAGGGATGAAGG + Intronic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1098356659 12:69618597-69618619 CCTTGACAGCTGTGGGATGATGG - Intergenic
1098922558 12:76315839-76315861 CATGGAGCCATGAGGGAGGAAGG - Intergenic
1099305657 12:80951825-80951847 CATAAAGACCTGAGGGAAGGGGG - Intronic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1106482765 13:30149204-30149226 CACTTGGACCTGGGGGATGAAGG - Intergenic
1107131852 13:36905020-36905042 CACTGAGCACTGAGGGAAGACGG + Intronic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1107905871 13:45060817-45060839 CATGGAGCCGTGAGGGAGGAAGG - Intergenic
1109743882 13:66594662-66594684 CACTGGGACCTGATGGAGGAGGG - Intronic
1113369988 13:109715233-109715255 CATGGAGTCCTGTGGGATAACGG - Intergenic
1114206879 14:20580285-20580307 CTTTGAAACCTGAAGGATTAAGG + Intergenic
1114252025 14:20969846-20969868 CATTGAGACCTGAGAGCTCACGG - Intergenic
1114631870 14:24164435-24164457 CATTGAGCCCTGAGGCCTCATGG + Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1117583826 14:57179752-57179774 AAGAGAGACCTGAGGGATCATGG + Intergenic
1117678974 14:58184035-58184057 AACTGAGTCCTGAAGGATGAAGG + Intronic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1126138349 15:45414188-45414210 CGCTGAGACCTGAGTGATGAGGG + Intronic
1127294473 15:57597486-57597508 CCTTGAGCCTTGTGGGATGAAGG + Intronic
1127782084 15:62325882-62325904 CACTGAGACCTCAGCGACGATGG + Intergenic
1128239164 15:66089246-66089268 CAGAGAGGCCTGAGTGATGAAGG - Intronic
1128904177 15:71452455-71452477 CTTTGAGAGCTGAGGGAGGAGGG - Intronic
1129940640 15:79494158-79494180 CAATGAGACCAGAGGCATGGAGG + Intergenic
1129985703 15:79918386-79918408 CATTGAGGCCTTAGGGATGAGGG + Intronic
1131034224 15:89210654-89210676 CAATGAGACAAGAGGGCTGAGGG - Intronic
1131372657 15:91896035-91896057 CATTGAGAACTGAAGGATTTAGG - Intronic
1136140016 16:28282405-28282427 CCCTGAGATCTGAGGGGTGACGG - Intergenic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139257637 16:65558152-65558174 CATTCACACCTGAGGGATGTAGG - Intergenic
1141298206 16:82789799-82789821 TATTGGGACCTGAGACATGAAGG - Intronic
1143581926 17:7832840-7832862 CACTGAAACCTGGGGGTTGAAGG - Exonic
1143857426 17:9862559-9862581 CTCTGAGACCTTAGGGAGGAAGG + Intronic
1144013482 17:11172058-11172080 CCTTTAGACCTGAGGGACGCAGG - Intergenic
1144650697 17:17005104-17005126 CCCTGGGACCTGAGGGCTGAGGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1145004946 17:19332519-19332541 CATTGAGCCCTGAGGGCAGGGGG - Intronic
1146172310 17:30643553-30643575 CATAGAGATCTGGGGGAAGAAGG + Intergenic
1146345763 17:32059574-32059596 CATAGAGATCTGGGGGAAGAAGG + Intergenic
1147895080 17:43745287-43745309 CATTGAAACCTGGGGGAACAAGG - Intergenic
1149538633 17:57452104-57452126 CACTGGAGCCTGAGGGATGAGGG - Intronic
1150851845 17:68711062-68711084 AATTTAGAGCTGAGGCATGAAGG + Intergenic
1151345870 17:73500812-73500834 GATGGAGAACTGAGGGAGGATGG - Intronic
1151524465 17:74654877-74654899 CACTGAGCCCTGAGGGATTTTGG - Intergenic
1151563359 17:74882862-74882884 CATAGATACCTGAGAGTTGATGG - Intronic
1151653916 17:75486593-75486615 CAGTGAGAGCTGTGGGATGGTGG + Intronic
1155519354 18:26653381-26653403 CACTGAGATCTAAAGGATGAAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1158263994 18:55639774-55639796 CATTGATACCTGAGGGGTAAGGG - Intronic
1159182518 18:64926805-64926827 AATTGAAGCCTGAGGAATGAAGG + Intergenic
1159270455 18:66142391-66142413 CATGAAGACCTGAAGGATCACGG + Intergenic
1159740374 18:72160622-72160644 CAGAGAGCCCTGATGGATGAGGG + Intergenic
1160247763 18:77173094-77173116 CTTTGAGAACTGATGGATTAGGG + Intergenic
1160292413 18:77606882-77606904 CATTGGGAACTGAGGTGTGATGG + Intergenic
1161648074 19:5466737-5466759 CATTCAGACGTGAGGGGTAAGGG + Intergenic
1162990117 19:14296492-14296514 CATAGAGATCTGGGGGAAGAAGG - Intergenic
1164350998 19:27341476-27341498 CATTGAGACCTAAGGGGAAATGG - Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165408466 19:35644221-35644243 GAATGGGACCTGCGGGATGAAGG - Exonic
1165494899 19:36146711-36146733 CATTGAGACCTGAGGGGATGAGG + Intronic
1165656154 19:37533947-37533969 CATTGTACCCTGAGGGCTGATGG + Intronic
1166122667 19:40694770-40694792 CATTGAGACCTGAGGGATGAGGG - Intronic
1166408911 19:42543283-42543305 CATCTAGACCTGAGGCAGGAGGG + Intronic
1166678806 19:44755231-44755253 CATCAACACCTGTGGGATGAAGG + Intronic
1167841786 19:52127985-52128007 CACGGAAACATGAGGGATGATGG + Intronic
926305601 2:11635560-11635582 CATTGAGCCCTGGGAAATGATGG + Intronic
926707102 2:15844641-15844663 CATTCTGATCTGAGGGATGAGGG - Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
929053995 2:37860422-37860444 CATTGAGTCCTGTGGGAGGAAGG + Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
932767112 2:74477697-74477719 CATAGAGCCCTGAGGAAGGAAGG - Intronic
934527011 2:95058295-95058317 CAGTGAGACATGAAGCATGACGG - Intergenic
937451073 2:122002554-122002576 CATTGAGAGCTGAGTCATGCCGG - Intergenic
940203209 2:151174182-151174204 CAGTGAGAGCTGAGGCCTGACGG - Intergenic
940672052 2:156682570-156682592 AATTGAGACCAGAGTGATGCAGG + Intergenic
941501637 2:166285769-166285791 CAGGGAGGCCTGAGAGATGAAGG + Intronic
942176086 2:173335937-173335959 CATTGAGACCTGAGGGGAGCAGG + Intergenic
945027127 2:205630121-205630143 CATGGAGAACTGGGGGAGGAGGG - Intergenic
946061110 2:216942302-216942324 CATTGAGCCCTGAGGGCTGTGGG - Intergenic
947159164 2:227194362-227194384 CAATGAGGGCTGAGGGGTGAGGG + Intronic
948261072 2:236604871-236604893 CATCCAGGCCTGGGGGATGAGGG - Intergenic
1169913935 20:10669472-10669494 CATTCAGGCCTGAAGCATGAAGG + Intronic
1170521643 20:17192076-17192098 CAGTGACCCCTGAGAGATGAGGG + Intergenic
1170555519 20:17511978-17512000 CATTGTGACGAGTGGGATGAGGG - Exonic
1171030943 20:21675794-21675816 CATTGAGCATTGAGGGTTGAAGG - Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1174292374 20:49518123-49518145 AAGGGAGACCTGAGGGATGGGGG + Intronic
1174530490 20:51208956-51208978 CCTTCAGAGCTGTGGGATGATGG + Intergenic
1176122081 20:63458491-63458513 GATTGAAGCCTGGGGGATGAGGG - Intronic
1176728594 21:10466056-10466078 AAGTGGGACCTGAGGGCTGAAGG + Intergenic
1178159245 21:29892687-29892709 CATAGAGACCTAAGGGCTTAAGG - Intronic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1183422960 22:37723057-37723079 CAGTGAGACCTGTAGGAGGAGGG + Intronic
1184336070 22:43853956-43853978 CAATGGGACCTTAAGGATGAGGG + Intronic
1184909175 22:47514695-47514717 CACTGAGACTTCAGGGATCAGGG - Intergenic
949851907 3:8428503-8428525 CAATAAGACCTGAGGGGTGAGGG - Intergenic
951616004 3:24544928-24544950 CAAAGAGACATGGGGGATGATGG + Intergenic
955092742 3:55768602-55768624 AACTGAGCCCTGAGGGATGGAGG + Intronic
955260775 3:57388181-57388203 CATGGAGGTCTGAGGGAAGAGGG - Intronic
956037721 3:65113265-65113287 CACTGTGACTTGACGGATGAAGG - Intergenic
958921952 3:100116861-100116883 CCTTGAGAAATCAGGGATGATGG - Intronic
960261590 3:115574345-115574367 GATTGAGACCTGAGAGATCCAGG + Intergenic
962305807 3:134284763-134284785 CATAGAGAAATGAGGGGTGATGG - Intergenic
962829148 3:139124318-139124340 CCTTGAGACATGAGGCAGGAAGG - Intronic
963209519 3:142673687-142673709 CATGGAGCACTGAGGGAGGAAGG - Intronic
966525196 3:180912535-180912557 CGTTGAGACCCCAGGGGTGAAGG + Exonic
967775194 3:193378982-193379004 CCTCAAGACCTGAGGAATGACGG + Intergenic
968761797 4:2446129-2446151 TAATGAGACCTGAAGGATGGTGG - Intronic
969462467 4:7335998-7336020 CTTTGTGACTTGGGGGATGATGG + Intronic
970432796 4:16004306-16004328 CATGGAGACCTGTGGCATGGAGG - Intronic
970598727 4:17623722-17623744 CAAGGAGCCCTGAGGGATGTCGG - Exonic
971864063 4:32145884-32145906 CATTCACACTTGAGGAATGAAGG + Intergenic
975742597 4:77443852-77443874 CATAGTGAACTGAGGGATGTTGG - Intergenic
977286904 4:95118943-95118965 CAATGAGACCAGAAGGATCAAGG - Intronic
977998405 4:103525134-103525156 CATTCAGAGCTGTGGCATGAAGG + Intergenic
978400029 4:108321615-108321637 CATTTAGAACTGTTGGATGAAGG + Intergenic
981608154 4:146562709-146562731 CATGGCCACCTGAGGGATAAGGG + Intergenic
983029445 4:162781195-162781217 CACTGAGACCTAAAGGAAGAGGG - Intergenic
983916718 4:173300481-173300503 GGCTGAGACCTGAAGGATGAGGG + Intronic
985606262 5:859805-859827 CCTTGAGTACTGAGGGAGGAGGG - Intronic
985837068 5:2279412-2279434 TATGCAGACCTGAGGGAGGAAGG + Intergenic
986150553 5:5126122-5126144 CATGGAGCAGTGAGGGATGAAGG - Intergenic
986164641 5:5263395-5263417 AATGAAGACCAGAGGGATGAAGG - Intronic
987133512 5:14880799-14880821 CATATAGACCTGAGGGAAAAAGG - Intergenic
988829712 5:34975880-34975902 CATTGAGATTTGGAGGATGAAGG + Intergenic
991447744 5:66717971-66717993 CAGTGAGAACTCAGGGATGGAGG - Intronic
995165751 5:109039623-109039645 CATGGACATCTGAGGGAAGAGGG + Intronic
995650948 5:114367588-114367610 CCTTGAGACTTGAGGTAGGAAGG - Intronic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997524652 5:134544505-134544527 CATGGAGCCCTGGGGGGTGAAGG + Intronic
998674074 5:144387647-144387669 TATTGAGATCTGAGGGATTAGGG + Intronic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1001678297 5:173536632-173536654 CACTGAGACCCCCGGGATGAGGG - Intergenic
1001761104 5:174209055-174209077 CACTGAGGCATGAGGGATAAGGG - Intronic
1003040773 6:2685488-2685510 CATCAAGACCAGAGGCATGAAGG - Exonic
1003429399 6:6025197-6025219 CATTGAAACCTGAAGGAAAAAGG + Intergenic
1003889142 6:10548428-10548450 CATTGCTACCTGAGTGATTAGGG + Intronic
1004203586 6:13572241-13572263 AATTGAGACTGGAAGGATGAGGG + Intergenic
1006939110 6:37739891-37739913 CTTGAAGAACTGAGGGATGAGGG - Intergenic
1012989434 6:105910195-105910217 CTTTGTGACCTGAGGGATAGAGG - Intergenic
1018137452 6:160791467-160791489 CATTGTGGCCTTGGGGATGAGGG - Intergenic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019504837 7:1385621-1385643 CACTGAGGCCTGAGGCAGGAGGG - Intergenic
1019735678 7:2648785-2648807 CAAGGAGACCTGAGCGAGGAGGG + Intronic
1021145589 7:17084835-17084857 CATTGATACCTGAGGAGTGAAGG + Intergenic
1024085063 7:45885681-45885703 AAGTGAGACCTCAGGGAGGATGG + Intergenic
1024189715 7:46993675-46993697 CCTGGAGATCTGAGGAATGAAGG - Intergenic
1025072689 7:55914613-55914635 GATTGAGACTGTAGGGATGAGGG + Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029129320 7:98318109-98318131 CAATGTGAACTGAGGGGTGAGGG - Intronic
1029387799 7:100255219-100255241 CACTGAGACCTGGGGGGTAATGG + Intronic
1032139695 7:129316472-129316494 CAAAAAGTCCTGAGGGATGAAGG - Intronic
1032450741 7:132028812-132028834 CACTGACCCCTGAGGGATGAGGG + Intergenic
1033022325 7:137738913-137738935 CAACGAGACCTGAGGGATGAGGG - Intronic
1033519339 7:142145227-142145249 AATTGACACCTGAGGGATTTGGG - Intronic
1035782234 8:2237585-2237607 CATTGAGACCTGTTGGCTGCGGG + Intergenic
1035809882 8:2481999-2482021 CATTGAGACCTGTTGGCTGCGGG - Intergenic
1035961937 8:4147347-4147369 CACTGAGGACTGAGGGAAGAAGG - Intronic
1036013872 8:4758904-4758926 CATTCAGTGGTGAGGGATGAGGG + Intronic
1037331549 8:17748365-17748387 CATGGACACCTGAAGGATGGTGG - Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1038328575 8:26590456-26590478 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328585 8:26590516-26590538 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328595 8:26590576-26590598 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328605 8:26590636-26590658 CAGTGACACCTGAGGGTGGATGG - Intronic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1042949292 8:74184574-74184596 CATTGAGAACTGAGAGGTGGTGG + Intergenic
1044947287 8:97401233-97401255 GATTGAGACCTCAGGGGTGCAGG - Intergenic
1045108979 8:98921440-98921462 CATGGAGTGCTGAGGGAGGAAGG + Intronic
1046314564 8:112482161-112482183 CACAGAGCACTGAGGGATGAAGG - Intronic
1047429808 8:124781389-124781411 CATTCAGACCTGTGGGCTGCAGG - Intergenic
1048828657 8:138454610-138454632 AATTAAGACCTGAGTGATGGAGG - Intronic
1048958677 8:139557794-139557816 CAGTGACACTTGAGGGATAAGGG + Intergenic
1051038445 9:12776731-12776753 GATTGAGACTTGAGGGAGAAGGG - Intronic
1052723743 9:32204046-32204068 CAATGAGACCTGGGGAATTAGGG + Intergenic
1052767692 9:32658353-32658375 CATTGACCCCTGTGGGATCAAGG + Intergenic
1055197557 9:73614940-73614962 CAATGAGACGAGAGAGATGATGG - Intergenic
1059671248 9:116494394-116494416 TATTCAGACCTGAGGGAGCAGGG - Intronic
1059778538 9:117501659-117501681 CATTGGGACCTGAGGGTGGAGGG - Intergenic
1062008949 9:134256898-134256920 TTTTGAGCCCTGTGGGATGAGGG + Intergenic
1062722681 9:138052714-138052736 CATTGAGACCTGAGGCAATGGGG + Intronic
1185924355 X:4129897-4129919 CATTCAGACCTCAGGGAGCAAGG - Intergenic
1187211995 X:17241103-17241125 CAATGAGCCCTGAGGCATGCAGG - Intergenic
1187268822 X:17761550-17761572 CACCAAGACCTGAAGGATGATGG + Intergenic
1189925665 X:45951853-45951875 CAAGGAGCCCTGAGGGATGTCGG + Intergenic
1190230539 X:48578660-48578682 CATTGAGGCCTGAGGCCTGCTGG + Exonic
1196111704 X:111953583-111953605 CCTGGAGGCCTCAGGGATGAGGG - Intronic
1200366055 X:155665752-155665774 CAGTGAGAAGTGGGGGATGAAGG + Intronic