ID: 1166130279

View in Genome Browser
Species Human (GRCh38)
Location 19:40741961-40741983
Sequence AGTGATCCGCAGCAGAGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 333}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166130274_1166130279 -3 Left 1166130274 19:40741941-40741963 CCCCAATGGAAAAGTTAAGGAGT 0: 1
1: 0
2: 2
3: 28
4: 218
Right 1166130279 19:40741961-40741983 AGTGATCCGCAGCAGAGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 333
1166130276_1166130279 -5 Left 1166130276 19:40741943-40741965 CCAATGGAAAAGTTAAGGAGTGA 0: 1
1: 0
2: 3
3: 16
4: 173
Right 1166130279 19:40741961-40741983 AGTGATCCGCAGCAGAGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 333
1166130269_1166130279 19 Left 1166130269 19:40741919-40741941 CCCTGAGGTAGTGATACCTGAGC 0: 1
1: 0
2: 5
3: 33
4: 248
Right 1166130279 19:40741961-40741983 AGTGATCCGCAGCAGAGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 333
1166130272_1166130279 3 Left 1166130272 19:40741935-40741957 CCTGAGCCCCAATGGAAAAGTTA 0: 1
1: 0
2: 1
3: 11
4: 93
Right 1166130279 19:40741961-40741983 AGTGATCCGCAGCAGAGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 333
1166130275_1166130279 -4 Left 1166130275 19:40741942-40741964 CCCAATGGAAAAGTTAAGGAGTG 0: 1
1: 0
2: 2
3: 13
4: 217
Right 1166130279 19:40741961-40741983 AGTGATCCGCAGCAGAGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 333
1166130270_1166130279 18 Left 1166130270 19:40741920-40741942 CCTGAGGTAGTGATACCTGAGCC 0: 1
1: 0
2: 1
3: 11
4: 115
Right 1166130279 19:40741961-40741983 AGTGATCCGCAGCAGAGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166130279 Original CRISPR AGTGATCCGCAGCAGAGGGC TGG Exonic
901875433 1:12164685-12164707 ATTGGTGCGCAGCAAAGGGCAGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904857982 1:33514489-33514511 GGTGATGCCCAGCAGAGTGCTGG + Exonic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905847414 1:41243863-41243885 AGTGGTCCCCAACAGAGAGCTGG - Intergenic
905849992 1:41266632-41266654 AGTGACCCAAATCAGAGGGCAGG + Intergenic
907312291 1:53545831-53545853 CGTGAGTCGCTGCAGAGGGCGGG + Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910538006 1:88322137-88322159 AGTGATGCTTAGCAGAGTGCTGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911725407 1:101236956-101236978 AGTGCTCCGCTGCGGAGGGAGGG + Exonic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912152795 1:106880421-106880443 AGTGAACCTCAGCAGTGGCCTGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
915271434 1:154756452-154756474 ACTGAGCCGCAGAAGGGGGCAGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918155751 1:181844946-181844968 AGGGAATCTCAGCAGAGGGCAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919601035 1:199622352-199622374 AGTGATCTTCAGGAGAGGGGAGG - Intergenic
920673848 1:208025292-208025314 TGTGATTCCCAGGAGAGGGCTGG - Exonic
924199708 1:241646203-241646225 AGTGGTCTGCTGCAGAGAGCTGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065698888 10:28405437-28405459 AGTGAGCCAGTGCAGAGGGCAGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068102935 10:52579488-52579510 ACAGATCTGCAGAAGAGGGCTGG + Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070484086 10:76913188-76913210 AGTGCTGCTCAGCAGAGGGGTGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076541416 10:131217490-131217512 AGGACTCAGCAGCAGAGGGCTGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077434828 11:2533984-2534006 AGGGAGCCTCAGCAGAGGGGAGG - Intronic
1078475412 11:11624986-11625008 AATGATCCCCAGCAGGAGGCAGG - Intergenic
1079141006 11:17809654-17809676 AGTGGGACGCAGAAGAGGGCAGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083151658 11:60795444-60795466 TAAGATCCACAGCAGAGGGCAGG - Intronic
1084683500 11:70680521-70680543 AGGGATCCTCATCAGAGGGCAGG - Intronic
1085283936 11:75348044-75348066 AGTGTGAGGCAGCAGAGGGCTGG - Intronic
1086419852 11:86628055-86628077 AATCATCTGCACCAGAGGGCAGG - Intronic
1088571835 11:111230337-111230359 AGTGATCCACAGCAAAGCGTAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089946562 11:122480007-122480029 AGTGAACATCAGCAGAGGTCTGG + Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090401684 11:126453271-126453293 AGTGTTCCCCAGCAGATAGCGGG - Intronic
1090873210 11:130766326-130766348 AGTGATCTGCAGGGGAAGGCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094741729 12:33296871-33296893 AGTGATCTTCAGCAGTGGCCTGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096556658 12:52408056-52408078 AGTGAGCTGCACCGGAGGGCAGG + Intergenic
1096556683 12:52408174-52408196 AGAGCTCAGGAGCAGAGGGCAGG + Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097731451 12:63132898-63132920 TGTGCTCTGAAGCAGAGGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098782521 12:74704750-74704772 AGTGATGCTCAGCAGAGAGCTGG + Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101102433 12:101407584-101407606 AGGGAGCCGCGGCCGAGGGCTGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103082824 12:118038906-118038928 AGTGATCAGCACCTGAGGTCAGG - Intronic
1103718958 12:122963322-122963344 AAGGGTCCCCAGCAGAGGGCTGG + Intronic
1104572265 12:129935516-129935538 AGGGAGCTGCAGTAGAGGGCTGG + Intergenic
1105015448 12:132783964-132783986 AGTGATCCTCCCCAGAGGGCTGG + Intronic
1105424003 13:20278365-20278387 AGTGATCCGCCGAGGTGGGCGGG + Intergenic
1106490383 13:30216278-30216300 GGTGACCCCCAGCAGAGGGCAGG + Intronic
1107871068 13:44746970-44746992 AGTGATACCCAGCAGAGCGGGGG + Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113050418 13:106205408-106205430 AATGATCCACAGTAGAGTGCAGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119529630 14:75350713-75350735 AGTGATTTGCACCAGAGGGTGGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120959938 14:90115313-90115335 AGTGACCAGCAGGAGCGGGCTGG - Intronic
1124339395 15:28880134-28880156 TCTGATCCGCAGCAGAGTGTTGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128244794 15:66125874-66125896 AGAGAAGCCCAGCAGAGGGCTGG + Intronic
1129243870 15:74268249-74268271 AGTGATTGTCTGCAGAGGGCTGG + Intronic
1131559153 15:93424368-93424390 AGTGTGCCGCAGCTGGGGGCAGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132860808 16:2070886-2070908 AAGGACCTGCAGCAGAGGGCTGG + Intronic
1135984466 16:27173887-27173909 TGGGATCTGCAGCAGCGGGCTGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138426017 16:56932432-56932454 TGGCATCCCCAGCAGAGGGCGGG - Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139328346 16:66168888-66168910 AGGGACCCGCTGCAGAGGGCAGG + Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142380654 16:89730166-89730188 AGAGATGCGAAGCAGAGGGCAGG + Intronic
1143302624 17:5922199-5922221 AGGGATCCCCAGAAGTGGGCAGG - Intronic
1145869951 17:28265827-28265849 ACTGGTCCGCAGGGGAGGGCCGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1148381343 17:47200650-47200672 AGGGATCTAAAGCAGAGGGCAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152361852 17:79836514-79836536 GGTGATCCACAGCTGGGGGCTGG + Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1158658054 18:59359009-59359031 AGTAAGCCGGAGCAGAGGGCTGG - Exonic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160130889 18:76223864-76223886 AGGCATTTGCAGCAGAGGGCTGG + Intergenic
1160799802 19:962493-962515 AAGGATCAGCAGCAGAGGGTTGG - Intronic
1162365112 19:10243792-10243814 TTTGATCCACAGGAGAGGGCTGG + Intergenic
1163452077 19:17384219-17384241 AGAGATGACCAGCAGAGGGCGGG + Intergenic
1163737923 19:18992842-18992864 AGTTACACGCAGCAGAGTGCTGG + Exonic
1165259102 19:34597751-34597773 TGTGAGCAGCAGCAGAGAGCGGG + Intronic
1165720802 19:38078284-38078306 AGTGAGCACCAGAAGAGGGCAGG - Intronic
1166130279 19:40741961-40741983 AGTGATCCGCAGCAGAGGGCTGG + Exonic
1166408283 19:42539451-42539473 AGTGAACATCAGCAGAGGACGGG - Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926099382 2:10104387-10104409 AGTGATATGCAGCAGAGAACAGG + Intergenic
927418270 2:22902698-22902720 AGAGATCCTCTGCCGAGGGCAGG + Intergenic
930644166 2:53886371-53886393 AGTGAAAGGCAGCAGAGGGCTGG + Intronic
932363514 2:71130263-71130285 AGAGACGCGCGGCAGAGGGCGGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937246966 2:120499875-120499897 AGTGGGCCACAGCAGTGGGCGGG - Intergenic
938074731 2:128325739-128325761 GGTGCTCCGCTGGAGAGGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942276274 2:174326303-174326325 AGGGATTCGCAGCAGGGGGTGGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946166549 2:217867820-217867842 AGTGTTCCTCCTCAGAGGGCCGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948497265 2:238359388-238359410 AGTGAACCAGAGCAGAGGGGTGG - Intronic
1172571909 20:35977166-35977188 TGTGCACCGCAGTAGAGGGCGGG + Intronic
1172618069 20:36302611-36302633 AGTGACCTCCAGCAGAGAGCTGG - Intergenic
1172865098 20:38089839-38089861 ACAGGTCCCCAGCAGAGGGCAGG - Exonic
1175917100 20:62431179-62431201 AGTGCTTCGCAGGAGGGGGCAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178270238 21:31182785-31182807 AGTGATCCTCAGGAGAGGACAGG + Intronic
1179410443 21:41159115-41159137 TGGGATCCGCAGCTGAGGGAGGG - Intergenic
1179417277 21:41208741-41208763 AGAGATGGGGAGCAGAGGGCAGG - Intronic
1180040654 21:45277653-45277675 AGTGAGTGGGAGCAGAGGGCGGG - Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180617829 22:17140143-17140165 AGTGCTCGTCAGCAGAGGGTGGG - Intronic
1181526541 22:23492589-23492611 AGTGATCTGCAGCAGTGGCCAGG - Intergenic
1181869433 22:25886261-25886283 TGGGATGCACAGCAGAGGGCTGG + Intronic
1183307145 22:37088616-37088638 AGTGATCAGGATCAGAGGGCAGG - Intronic
1184411000 22:44326404-44326426 AGAGATGCCCAGCAGAGGGAGGG - Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184806278 22:46796721-46796743 GGTGGGCAGCAGCAGAGGGCGGG + Intronic
1184953438 22:47862596-47862618 AGAGGTCAGCAGCAGGGGGCCGG - Intergenic
1185322065 22:50206025-50206047 AGGGTTCCGCAGCAGAAGCCAGG - Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
954170443 3:48797748-48797770 GGTGATGCTCTGCAGAGGGCTGG + Intronic
954568048 3:51615709-51615731 AGTGAGCCCCAGCAGTGGGGAGG + Intronic
954865407 3:53724792-53724814 ACTCATCCACAGCAGAGAGCTGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
961676995 3:128573684-128573706 AGTGGTCCGCTGCAGTGAGCTGG - Exonic
962804172 3:138915453-138915475 AGTGATCTGGAGCCCAGGGCTGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966269262 3:178085014-178085036 AGAGATCTGCAGCAGGAGGCGGG + Intergenic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968542767 4:1176240-1176262 TGTGACCCTCAGCAGAAGGCAGG - Intronic
968874462 4:3258066-3258088 AGTGGTCAGCAGCTGGGGGCAGG - Intronic
971265826 4:25095590-25095612 AGTGATCCTAAGGAAAGGGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
981568791 4:146130588-146130610 TGTGATGCTCAGCAGAGGTCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984784976 4:183559209-183559231 AGTGAAGCGCAGAAAAGGGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987088800 5:14492727-14492749 AGTGCCCCGCAGCTGAGGGCTGG + Exonic
987114200 5:14713582-14713604 GATGATCCGCAGCACAGAGCTGG + Exonic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988585652 5:32505352-32505374 GGTGGACCACAGCAGAGGGCGGG + Intergenic
988706075 5:33727109-33727131 AGTGTCCAGCAGCATAGGGCAGG - Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994525998 5:100904959-100904981 AGGGATCCGGGGCTGAGGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996956485 5:129188515-129188537 AGTGAACTGCAGCAGTGGCCAGG + Intergenic
997350895 5:133230698-133230720 AGTGATCCCCAGTAGAGAGTTGG - Intronic
997764646 5:136488429-136488451 AATGTTCTTCAGCAGAGGGCAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004466199 6:15887556-15887578 AGTGAAGCTCAGCAGAGAGCTGG + Intergenic
1004485045 6:16058588-16058610 CTTGATCCTGAGCAGAGGGCAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011792273 6:90911273-90911295 AGTGAGCCCCAGAACAGGGCAGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014800632 6:125774008-125774030 AGAGCTCCACAGCAGAGGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019839731 7:3428927-3428949 AGAGATCAGCAGCAGTGGGTAGG + Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021939687 7:25667463-25667485 AGTCATCCACAGTAGAGAGCAGG - Intergenic
1022833143 7:34088301-34088323 TGAGATCACCAGCAGAGGGCAGG - Intronic
1023581892 7:41692412-41692434 AGTTCTCTGCAGCAGAAGGCAGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028733150 7:94176445-94176467 AGTGATCAGCATCAGAGACCAGG - Intergenic
1030007776 7:105135434-105135456 AGAGAGCAGCAGCAGAGGGAAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032698943 7:134361929-134361951 AGTGGTCCTCAGCTGGGGGCTGG - Intergenic
1036130459 8:6104644-6104666 AGGGATCCGAAGCAGAGAGTGGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039879868 8:41618464-41618486 ACTGATCTGTAGCAGAGGCCGGG + Intronic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042829326 8:73009259-73009281 CGTGGTGCGCGGCAGAGGGCTGG + Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046080367 8:109363135-109363157 AGTAATACCCAGAAGAGGGCTGG + Intronic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1049441471 8:142611716-142611738 AGTCGGCTGCAGCAGAGGGCAGG - Exonic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1053129940 9:35609152-35609174 AGTGAGCGGCAGCGGCGGGCAGG - Exonic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056565871 9:87771759-87771781 AGTGAGCCTGAGCAGAGGGTGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058778839 9:108312595-108312617 AGTGATTCTCAACAGAGGGAGGG - Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1060471897 9:123954960-123954982 AGTCTTCCTCAGCAGAAGGCTGG - Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062189506 9:135240586-135240608 AGTGATTTTCAGCAGAGGGGTGG - Intergenic
1062436898 9:136550417-136550439 AGTGATCCCCAGCTGTGGCCAGG + Intergenic
1185611210 X:1394710-1394732 AGTGACCCGCCCCAGAGAGCGGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186471410 X:9824888-9824910 AGTGTCCCGCAGGAGATGGCTGG - Intronic
1186766665 X:12777624-12777646 TGTGATCCTCAGCAGAGGGGAGG - Intergenic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189733786 X:44048951-44048973 AGTGAACAGCAGAGGAGGGCTGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192374857 X:70549246-70549268 AGTGATCAGCAGCAGTAGCCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1198775695 X:140176732-140176754 AGTGATCCCCAGCAGGGCCCTGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic