ID: 1166137570

View in Genome Browser
Species Human (GRCh38)
Location 19:40786642-40786664
Sequence CTGCAGGGGCACACACTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166137570_1166137576 11 Left 1166137570 19:40786642-40786664 CCTCAGAGTGTGTGCCCCTGCAG 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1166137576 19:40786676-40786698 CTGGAGACCAGCGCTCTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 111
1166137570_1166137578 22 Left 1166137570 19:40786642-40786664 CCTCAGAGTGTGTGCCCCTGCAG 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1166137578 19:40786687-40786709 CGCTCTCACAGGCGAGAACGTGG 0: 1
1: 0
2: 0
3: 1
4: 24
1166137570_1166137580 28 Left 1166137570 19:40786642-40786664 CCTCAGAGTGTGTGCCCCTGCAG 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182
1166137570_1166137573 -8 Left 1166137570 19:40786642-40786664 CCTCAGAGTGTGTGCCCCTGCAG 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1166137573 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 3
3: 31
4: 254
1166137570_1166137579 25 Left 1166137570 19:40786642-40786664 CCTCAGAGTGTGTGCCCCTGCAG 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1166137579 19:40786690-40786712 TCTCACAGGCGAGAACGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166137570 Original CRISPR CTGCAGGGGCACACACTCTG AGG (reversed) Intronic