ID: 1166137571

View in Genome Browser
Species Human (GRCh38)
Location 19:40786656-40786678
Sequence CAGGAACATCAGCTCTGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166137571_1166137579 11 Left 1166137571 19:40786656-40786678 CCCCTGCAGAGCTGATGTTCCTG 0: 1
1: 0
2: 3
3: 47
4: 300
Right 1166137579 19:40786690-40786712 TCTCACAGGCGAGAACGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 112
1166137571_1166137578 8 Left 1166137571 19:40786656-40786678 CCCCTGCAGAGCTGATGTTCCTG 0: 1
1: 0
2: 3
3: 47
4: 300
Right 1166137578 19:40786687-40786709 CGCTCTCACAGGCGAGAACGTGG 0: 1
1: 0
2: 0
3: 1
4: 24
1166137571_1166137576 -3 Left 1166137571 19:40786656-40786678 CCCCTGCAGAGCTGATGTTCCTG 0: 1
1: 0
2: 3
3: 47
4: 300
Right 1166137576 19:40786676-40786698 CTGGAGACCAGCGCTCTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 111
1166137571_1166137580 14 Left 1166137571 19:40786656-40786678 CCCCTGCAGAGCTGATGTTCCTG 0: 1
1: 0
2: 3
3: 47
4: 300
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166137571 Original CRISPR CAGGAACATCAGCTCTGCAG GGG (reversed) Exonic