ID: 1166137572

View in Genome Browser
Species Human (GRCh38)
Location 19:40786657-40786679
Sequence CCAGGAACATCAGCTCTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166137572_1166137578 7 Left 1166137572 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 1
3: 25
4: 265
Right 1166137578 19:40786687-40786709 CGCTCTCACAGGCGAGAACGTGG 0: 1
1: 0
2: 0
3: 1
4: 24
1166137572_1166137576 -4 Left 1166137572 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 1
3: 25
4: 265
Right 1166137576 19:40786676-40786698 CTGGAGACCAGCGCTCTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 111
1166137572_1166137580 13 Left 1166137572 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 1
3: 25
4: 265
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182
1166137572_1166137579 10 Left 1166137572 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 1
3: 25
4: 265
Right 1166137579 19:40786690-40786712 TCTCACAGGCGAGAACGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166137572 Original CRISPR CCAGGAACATCAGCTCTGCA GGG (reversed) Exonic