ID: 1166137573

View in Genome Browser
Species Human (GRCh38)
Location 19:40786657-40786679
Sequence CCCTGCAGAGCTGATGTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166137568_1166137573 -2 Left 1166137568 19:40786636-40786658 CCCTGACCTCAGAGTGTGTGCCC 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1166137573 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 3
3: 31
4: 254
1166137570_1166137573 -8 Left 1166137570 19:40786642-40786664 CCTCAGAGTGTGTGCCCCTGCAG 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1166137573 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 3
3: 31
4: 254
1166137569_1166137573 -3 Left 1166137569 19:40786637-40786659 CCTGACCTCAGAGTGTGTGCCCC 0: 1
1: 0
2: 1
3: 22
4: 339
Right 1166137573 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 3
3: 31
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166137573 Original CRISPR CCCTGCAGAGCTGATGTTCC TGG Exonic