ID: 1166137574

View in Genome Browser
Species Human (GRCh38)
Location 19:40786658-40786680
Sequence TCCAGGAACATCAGCTCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166137574_1166137576 -5 Left 1166137574 19:40786658-40786680 CCTGCAGAGCTGATGTTCCTGGA 0: 1
1: 1
2: 1
3: 32
4: 239
Right 1166137576 19:40786676-40786698 CTGGAGACCAGCGCTCTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 111
1166137574_1166137580 12 Left 1166137574 19:40786658-40786680 CCTGCAGAGCTGATGTTCCTGGA 0: 1
1: 1
2: 1
3: 32
4: 239
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182
1166137574_1166137579 9 Left 1166137574 19:40786658-40786680 CCTGCAGAGCTGATGTTCCTGGA 0: 1
1: 1
2: 1
3: 32
4: 239
Right 1166137579 19:40786690-40786712 TCTCACAGGCGAGAACGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 112
1166137574_1166137578 6 Left 1166137574 19:40786658-40786680 CCTGCAGAGCTGATGTTCCTGGA 0: 1
1: 1
2: 1
3: 32
4: 239
Right 1166137578 19:40786687-40786709 CGCTCTCACAGGCGAGAACGTGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166137574 Original CRISPR TCCAGGAACATCAGCTCTGC AGG (reversed) Exonic