ID: 1166137575

View in Genome Browser
Species Human (GRCh38)
Location 19:40786675-40786697
Sequence CTGTGAGAGCGCTGGTCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166137575_1166137580 -5 Left 1166137575 19:40786675-40786697 CCTGGAGACCAGCGCTCTCACAG 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182
1166137575_1166137579 -8 Left 1166137575 19:40786675-40786697 CCTGGAGACCAGCGCTCTCACAG 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1166137579 19:40786690-40786712 TCTCACAGGCGAGAACGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166137575 Original CRISPR CTGTGAGAGCGCTGGTCTCC AGG (reversed) Exonic