ID: 1166137580

View in Genome Browser
Species Human (GRCh38)
Location 19:40786693-40786715
Sequence CACAGGCGAGAACGTGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166137572_1166137580 13 Left 1166137572 19:40786657-40786679 CCCTGCAGAGCTGATGTTCCTGG 0: 1
1: 1
2: 1
3: 25
4: 265
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182
1166137575_1166137580 -5 Left 1166137575 19:40786675-40786697 CCTGGAGACCAGCGCTCTCACAG 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182
1166137570_1166137580 28 Left 1166137570 19:40786642-40786664 CCTCAGAGTGTGTGCCCCTGCAG 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182
1166137571_1166137580 14 Left 1166137571 19:40786656-40786678 CCCCTGCAGAGCTGATGTTCCTG 0: 1
1: 0
2: 3
3: 47
4: 300
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182
1166137574_1166137580 12 Left 1166137574 19:40786658-40786680 CCTGCAGAGCTGATGTTCCTGGA 0: 1
1: 1
2: 1
3: 32
4: 239
Right 1166137580 19:40786693-40786715 CACAGGCGAGAACGTGGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166137580 Original CRISPR CACAGGCGAGAACGTGGAGG AGG Exonic