ID: 1166140367

View in Genome Browser
Species Human (GRCh38)
Location 19:40802158-40802180
Sequence CAGGAGAAGCAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1782
Summary {0: 1, 1: 0, 2: 17, 3: 229, 4: 1535}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166140359_1166140367 -6 Left 1166140359 19:40802141-40802163 CCATCCTGTCTCCAAGGCAGGAG 0: 1
1: 0
2: 3
3: 84
4: 971
Right 1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG 0: 1
1: 0
2: 17
3: 229
4: 1535
1166140360_1166140367 -10 Left 1166140360 19:40802145-40802167 CCTGTCTCCAAGGCAGGAGAAGC 0: 1
1: 0
2: 0
3: 25
4: 251
Right 1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG 0: 1
1: 0
2: 17
3: 229
4: 1535
1166140351_1166140367 29 Left 1166140351 19:40802106-40802128 CCATCCCTGTTTGCTGGCCCATG 0: 1
1: 0
2: 3
3: 29
4: 243
Right 1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG 0: 1
1: 0
2: 17
3: 229
4: 1535
1166140354_1166140367 12 Left 1166140354 19:40802123-40802145 CCCATGTTTCTAGTCCATCCATC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG 0: 1
1: 0
2: 17
3: 229
4: 1535
1166140352_1166140367 25 Left 1166140352 19:40802110-40802132 CCCTGTTTGCTGGCCCATGTTTC 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG 0: 1
1: 0
2: 17
3: 229
4: 1535
1166140353_1166140367 24 Left 1166140353 19:40802111-40802133 CCTGTTTGCTGGCCCATGTTTCT 0: 1
1: 0
2: 0
3: 17
4: 171
Right 1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG 0: 1
1: 0
2: 17
3: 229
4: 1535
1166140357_1166140367 -2 Left 1166140357 19:40802137-40802159 CCATCCATCCTGTCTCCAAGGCA 0: 1
1: 2
2: 5
3: 47
4: 363
Right 1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG 0: 1
1: 0
2: 17
3: 229
4: 1535
1166140355_1166140367 11 Left 1166140355 19:40802124-40802146 CCATGTTTCTAGTCCATCCATCC 0: 1
1: 0
2: 1
3: 18
4: 159
Right 1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG 0: 1
1: 0
2: 17
3: 229
4: 1535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166140367 Original CRISPR CAGGAGAAGCAGAAGGGGGA GGG Intronic
900183179 1:1321316-1321338 CAGGGGAAGCTGGCGGGGGAGGG - Intronic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
900804296 1:4757208-4757230 CAGGGGAGGCGGAAAGGGGAGGG - Intronic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901105382 1:6751857-6751879 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901395906 1:8981409-8981431 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
901483247 1:9540087-9540109 CAGGAGAAGGGGGCGGGGGAGGG - Intronic
901658701 1:10785568-10785590 GAGGAGAAGCAGAGGTGGGGTGG - Intronic
902403854 1:16172545-16172567 CAGGAGAAACAGTAGGGTGGAGG - Intergenic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903352307 1:22725023-22725045 CACCAAGAGCAGAAGGGGGAGGG - Intronic
903394106 1:22986075-22986097 CAGAAGAAGCAGGGGAGGGATGG + Intergenic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904136335 1:28315472-28315494 GAGGAGAAGCAGTATGGCGAAGG - Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904679035 1:32216027-32216049 TAGGAGCAGGAGAACGGGGAGGG - Exonic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904821895 1:33250893-33250915 AAGGAGAAGAAGAAGGTGCATGG + Intergenic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905124568 1:35707885-35707907 GAGGAGACACAAAAGGGGGAGGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905403587 1:37719214-37719236 CAGGAGAAGCAGAAGTGACCAGG + Intronic
905408534 1:37753330-37753352 CAGGAGAAGCAGGGGCGCGAGGG + Intronic
905901237 1:41583184-41583206 CAGGAGAGGCACAGGGGGGGCGG + Exonic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180845 1:43817591-43817613 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906191961 1:43904724-43904746 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192324 1:43906042-43906064 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906723053 1:48023261-48023283 CAGGCGGGGCAGAAGGGGCAGGG - Intergenic
906960809 1:50418657-50418679 CCGGAGAAGCAGTAGGGCGAGGG - Exonic
907242768 1:53089957-53089979 GAGGAGCAGCAGGAGGGGCAGGG + Intronic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907734365 1:57097415-57097437 CAGGAGAAGAAGGAGCTGGAGGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907990982 1:59582556-59582578 TAGGAGAAGGAGTAGAGGGAAGG - Intronic
908353160 1:63306231-63306253 GAGGAGAAGGAGGAAGGGGAAGG + Intergenic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
908792699 1:67798576-67798598 GAGGAGAAGGAGGAAGGGGAGGG - Intronic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
910799771 1:91133422-91133444 CAGGAGAAAAAGGAGGGGAAAGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912720980 1:112019764-112019786 CAGGACAAGTTAAAGGGGGAGGG + Intergenic
912794949 1:112687618-112687640 CAGGAGGAGCAGAGGTGGGCAGG - Intronic
912950765 1:114118757-114118779 GAGGAGAGGCAGATGGGGGTGGG - Intronic
913076432 1:115344204-115344226 CAGGTGAAGGAGTAGGGAGAAGG - Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913380302 1:118203085-118203107 CAGGAGAAGCTGGAGGAGAAAGG - Intergenic
913458208 1:119055721-119055743 GAGGAGGAGGAGAAGAGGGAGGG + Intronic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
914058050 1:144183173-144183195 GAGGAGGAGGAGGAGGGGGAAGG - Intergenic
914121095 1:144783192-144783214 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
914474716 1:148013706-148013728 CAAGAGAAGCAGCAAGGGAAGGG + Intergenic
914964089 1:152237704-152237726 CAGGAGAAAGAGATGGGGGGAGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915388471 1:155518784-155518806 CAGGAGAGGTAGAGGGGAGACGG + Intronic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915596681 1:156900313-156900335 CAGGAGAAGGGGATGGGGGTGGG - Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
917335907 1:173924167-173924189 CAGGAGAAGCATAGTGGAGAGGG - Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918139951 1:181711764-181711786 CCCAAGGAGCAGAAGGGGGAAGG + Intronic
918157247 1:181860430-181860452 CAGGTGAAAAAGAAGGGGAATGG + Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016770 1:192048516-192048538 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919775199 1:201189979-201190001 CAGGTGAAGTAGAAGGGAAATGG - Intergenic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920158819 1:203979605-203979627 CAGGAGAATCATTTGGGGGAGGG - Intergenic
920441111 1:205980865-205980887 GAGGTGAAGGGGAAGGGGGAGGG - Intronic
920442398 1:205989675-205989697 CAGGGGAGGCAGAAGGGCCAGGG - Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
920850279 1:209623756-209623778 GAGGAGGAGCAGGAGGGAGAGGG + Intronic
921055310 1:211538513-211538535 CAGAAGGGGCAGATGGGGGAGGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921397084 1:214679859-214679881 GAGGAGGAGGAGAAGGGGGGAGG - Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
921921286 1:220672916-220672938 GAGGAGAAGGAGGAGGGGAAAGG + Intergenic
921924908 1:220703388-220703410 CAGGAGCAGCAGGAGAGAGAGGG + Intergenic
921945529 1:220883640-220883662 CATGGGAAGCAGAAAGGGAAAGG - Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922561293 1:226571621-226571643 AAGAAGAAGAAGAAGGGAGAAGG - Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922722751 1:227906882-227906904 AGGGAGAAGCAGAAGGGAAAGGG - Intergenic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072431 1:230577877-230577899 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923482382 1:234397324-234397346 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
923521630 1:234739428-234739450 AAGGGGCAGCAGAAGGGGCATGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924838561 1:247681538-247681560 CAGGAGAAGCAAACAGGGAAGGG - Intergenic
924920060 1:248619482-248619504 CAGGGGCTGCAGAAGAGGGAGGG + Intergenic
924952106 1:248894752-248894774 AAGGAGAAGAGGAAGGGGAAGGG - Intergenic
1062767174 10:74696-74718 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063216289 10:3928976-3928998 CAGGAGAAGGAGAAAGGGAGGGG + Intergenic
1063233245 10:4086728-4086750 CGGGGGAGGCAGAAGAGGGACGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063286251 10:4692080-4692102 AAGGGGAAGGAGAAGGGGAACGG + Intergenic
1063385201 10:5612195-5612217 CAGTAGAAGCTGGATGGGGAAGG - Intergenic
1063729636 10:8681611-8681633 GAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1064067554 10:12195702-12195724 GAGGAGAAGAAGAAGGGGAAAGG - Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066269479 10:33808398-33808420 CAGGTGAAGCAGAACTGGGGAGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067184166 10:44013046-44013068 GAGGAGAAGCAGAGGAGGAAAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067556484 10:47276835-47276857 GAGGAGGAGCAGATGTGGGAGGG - Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1068756390 10:60658956-60658978 CAGGAGGAGAGGAAGGGGAAGGG + Intronic
1068878384 10:62022354-62022376 CAGGAGGAAGATAAGGGGGAAGG + Intronic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069664347 10:70145040-70145062 GAGGAGAAGCAGCAGGGTTAGGG + Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070332596 10:75429110-75429132 AAGGAGAAGGAGGAGGGGAAAGG - Intergenic
1070397644 10:76025349-76025371 CAGGACAAGCATAGGAGGGATGG + Intronic
1070527407 10:77307140-77307162 CAAGATCAGCAGAAGGGGCATGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070680553 10:78446086-78446108 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1070759132 10:79012579-79012601 CAGGAGATGCAAAAGGCGGCTGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071971901 10:90916067-90916089 GGGGAGAAGGAGGAGGGGGAGGG + Intronic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073340775 10:102742906-102742928 CAGAAGAAGCAGCAAGGAGATGG + Exonic
1073340929 10:102744035-102744057 GAGCAGGAGCAGGAGGGGGATGG + Exonic
1073581124 10:104666352-104666374 CAGGAGGAGGAGAAGAGGAAAGG + Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1074217054 10:111395234-111395256 GAGCAGAAGGAGAAGAGGGAGGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074594927 10:114853954-114853976 AAGGAGAATCTGAAGAGGGAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075161664 10:120029648-120029670 GAGGAGGAGGGGAAGGGGGAAGG + Intergenic
1075173615 10:120139104-120139126 GAGTAGAAACAGAAGGGAGAGGG - Intergenic
1075221230 10:120586582-120586604 CAGGAGGACCAGAATGGGAAAGG + Intronic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1076312260 10:129517057-129517079 CTGGAGAAGCTGGAGTGGGAGGG - Intronic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076791626 10:132779719-132779741 CAGGACAAGCAGACGGGCGCCGG + Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1077147567 11:1052860-1052882 CCGGGGAAGCAGAAGGGAAAGGG - Intergenic
1077392575 11:2306919-2306941 GAGGAGATGGAGGAGGGGGAAGG + Intronic
1077392581 11:2306941-2306963 GAGGAGAAGGAGGAGGGAGAAGG + Intronic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1077545634 11:3168429-3168451 CAGATGTAGCAGAAGGGGCAGGG - Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079110717 11:17603611-17603633 CAGGAGAAGCAGTATGGGAAGGG - Intronic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080183740 11:29454497-29454519 CAGGTGAAGCATAGGGGGAAAGG + Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1081155472 11:39684415-39684437 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1081155475 11:39684421-39684443 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081567759 11:44270381-44270403 CAGGAGAAGAAGGAGGGAGGAGG - Intronic
1081569814 11:44282813-44282835 CAGGTGTAGGAGGAGGGGGAAGG + Intronic
1081596570 11:44463585-44463607 CAAGAGAAGCAGGAGAGGCAAGG + Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082196797 11:49316251-49316273 AAGGAGAAGGGGAAGGGGTAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082762064 11:57136792-57136814 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083224116 11:61273901-61273923 CAGGAGAGGAAGCAGGGTGAAGG - Intronic
1083271850 11:61576734-61576756 CAGGAGGGGCAGGAGGGGGAGGG + Intronic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083658409 11:64241274-64241296 CCGGAGATGCCGCAGGGGGAGGG + Intronic
1083894801 11:65614405-65614427 CAGGAGAGGCAGAGAGGGAAAGG + Intronic
1084104873 11:66974975-66974997 GAGGAGAAGGAGGAGGGGGGAGG + Intergenic
1084155784 11:67311765-67311787 CAGGAGCAGGAGCAGGGGCAGGG + Exonic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084571662 11:69963417-69963439 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1085279282 11:75319751-75319773 CAGGAGGAGCAGACAGGGAAAGG + Intronic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1085745809 11:79113242-79113264 GAGGAGAAGCAAGAGAGGGAAGG + Intronic
1085857166 11:80188334-80188356 CTGGAGAAGGAAAAGGGGCAGGG - Intergenic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086294906 11:85354403-85354425 CATGAGAAGAACAAAGGGGAAGG + Intronic
1086659027 11:89391934-89391956 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1087728518 11:101751911-101751933 CAGGAGACGAAGAAGAGGCATGG - Intronic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1087949636 11:104204871-104204893 AAGGAGGATCAGAAGGGAGAAGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088462048 11:110092862-110092884 GAGGAGAAGGAAAAGAGGGAAGG + Intergenic
1088524219 11:110735221-110735243 GAGGAGAAGCAGAGGAGGGGAGG + Intergenic
1088797255 11:113274262-113274284 CAGGAGAAGCAAGAGTGGGCTGG - Intronic
1088809667 11:113382808-113382830 AACGAGAAATAGAAGGGGGAAGG + Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089276263 11:117338063-117338085 CAAGAGCAGCAGAAGGCAGAAGG - Intronic
1089528310 11:119110978-119111000 GAGAAGAGGCAGAACGGGGAGGG + Intronic
1089542785 11:119200379-119200401 CAGGAGAAGGAGGTGGTGGAGGG - Intergenic
1089624676 11:119743487-119743509 CAGGTGAGGGAGGAGGGGGAAGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1089998797 11:122935138-122935160 CGGGAGAGGAAGAAGGGGAAGGG + Intronic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090256904 11:125290945-125290967 CAGGAGAAGCTGATGGGAGAAGG + Intronic
1090402847 11:126460103-126460125 CGGGAGCAGGAGGAGGGGGAAGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090817651 11:130314005-130314027 GAGAAAAAGCAGAAGGGGAAAGG + Intronic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091172657 11:133532185-133532207 CAGGAGAGGCAGTGGGGAGATGG - Intronic
1091198213 11:133749910-133749932 GAGGAGAGGGAGAAGAGGGAGGG - Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091690983 12:2597298-2597320 CAGGAGGAGCAGAAGGGGATGGG - Intronic
1091706477 12:2696916-2696938 CAAGAGAAGCAAAAGAGGGTGGG + Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092061948 12:5558160-5558182 CAGGAGGAAGATAAGGGGGACGG - Intronic
1092111454 12:5967708-5967730 CAGGAGGAGCAGCAGAGCGATGG - Intronic
1092334292 12:7614991-7615013 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1092566509 12:9671695-9671717 CAGGAGAAGCACTAGAGGTATGG - Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093084575 12:14852460-14852482 AAGGAGGAGGAGGAGGGGGAGGG - Intronic
1093143695 12:15539142-15539164 GAAGAGAATCAGAAGGGTGAGGG + Intronic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093591529 12:20907473-20907495 GAGGAGAAGAGGAAGGGGAAGGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095196880 12:39329591-39329613 GAGGAGAAGCAAGAGAGGGAGGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096596954 12:52701880-52701902 CAGGAGAAGCAGGCAGGGCATGG - Intronic
1096638281 12:52975036-52975058 GAGGAGAAGGAGCAGGGAGAGGG + Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097087688 12:56480683-56480705 CAAGAGGAGAAGAAGAGGGAAGG - Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099764101 12:86960548-86960570 AAGGAGAGGGAGAAGTGGGAAGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099959179 12:89380408-89380430 GAGGAGAAGGGGGAGGGGGAAGG - Intergenic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100245610 12:92753711-92753733 CTGGAGAGGCAGAAGGGAAAAGG - Intronic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100550742 12:95644399-95644421 AAGGGGGAGAAGAAGGGGGAAGG - Intergenic
1100559033 12:95728922-95728944 CAGGAGCAGCAGCAAGGGTAGGG - Intronic
1100705696 12:97197897-97197919 CAGCAGAACCAGAAGAGGTAAGG + Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101285367 12:103306497-103306519 TAGGAGAAGAAGAAGAGGGGAGG + Intronic
1101572017 12:105962332-105962354 CAGGAGGAGAAGAAAGGGTAGGG + Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102166744 12:110812994-110813016 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102340386 12:112116829-112116851 AAGGAGAAGAGGAAGGGTGAGGG - Intergenic
1102598035 12:114007777-114007799 CAGGAGTAGAAGCAGGGGGCTGG - Intergenic
1102625895 12:114235291-114235313 CAGGAGAATCAACAGGGGGCTGG - Intergenic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103235377 12:119368177-119368199 GAGGAGAAAAAGGAGGGGGAAGG + Intronic
1103265470 12:119626509-119626531 GAGGAGGAGGAGAAGGGAGAAGG + Intronic
1103371572 12:120423323-120423345 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1103410858 12:120710547-120710569 GAGGAGAAGAAGAAGGCGGGCGG + Exonic
1103506205 12:121443576-121443598 CAGGAGAGGCAGCAGTGGGGTGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103896587 12:124277570-124277592 CAGGAGAAGCCCGACGGGGAGGG - Intronic
1104085155 12:125467435-125467457 AAGGAGAAGAAGAAGAGGGTGGG - Intronic
1104091471 12:125521314-125521336 AAGGAAAAGGAGAAGGGGAAGGG - Intronic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1104884070 12:132094627-132094649 CAGGACAAGCAGCAGAGGCATGG - Intronic
1104946730 12:132417970-132417992 CAGGAGGAGCAGGCGGGGAAGGG - Intergenic
1105474684 13:20719962-20719984 CAGGAGAAAAACAAGAGGGAGGG - Intronic
1105600748 13:21884842-21884864 CAGGACAAACAGGAGGGGGGTGG + Intergenic
1105712705 13:23028375-23028397 CAGGAGAAAAAGAAGTGGGTTGG + Intergenic
1105726246 13:23164997-23165019 CAGGAGAAGGTGCAGTGGGAGGG - Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106423225 13:29601270-29601292 CAGGAGAAACTGGTGGGGGAGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106675883 13:31957633-31957655 GAGGAGGAGAAGAGGGGGGAAGG + Intergenic
1106771511 13:32965278-32965300 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1106929467 13:34648251-34648273 GAGAAGAAGAAGATGGGGGAGGG + Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107238386 13:38200375-38200397 AAGGGGAAGCGGAAGGGGAAGGG + Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107604072 13:42040961-42040983 AAGGAGAAGCGGGAGGGGGTGGG - Intronic
1107795451 13:44046897-44046919 AAGGAGAAGGGGAAGGGGAAAGG - Intergenic
1107795453 13:44046903-44046925 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1107795460 13:44046921-44046943 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108692901 13:52875812-52875834 CAGGAGGAGGGGCAGGGGGAAGG - Intergenic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1110519229 13:76455827-76455849 GAAGAGAAGCAGGAGAGGGAGGG + Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110860695 13:80341810-80341832 CGGGGGGAGAAGAAGGGGGAGGG + Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112406972 13:99129862-99129884 CAGGAGTAGCAGAGGTGGCAAGG + Intergenic
1112578461 13:100658264-100658286 CAGGAGTAGCAGAAAGGCAAAGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113110175 13:106814287-106814309 AAGGAGCAGGAGAAGGGGAAGGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113345350 13:109472363-109472385 AAGAAGAAGAAGAAGGGGAAAGG + Intergenic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113721802 13:112563059-112563081 CAGGAAAGTCCGAAGGGGGAGGG - Intronic
1113909687 13:113836269-113836291 GAGGAGGGGGAGAAGGGGGAGGG + Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114260113 14:21030517-21030539 GGGGTGAAGGAGAAGGGGGAGGG - Exonic
1114506102 14:23215181-23215203 CAGGAGAGGCAGAGGGGTGGGGG - Intronic
1114652205 14:24292384-24292406 CAGTAGAAGCAGAGAGGGCAGGG - Intronic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115529359 14:34312796-34312818 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1115659130 14:35474595-35474617 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1115786979 14:36837323-36837345 CAGGAGAAGGAGGAGGTGAAGGG + Intronic
1115936723 14:38560751-38560773 GAGCAGAAGCAAAAGAGGGAGGG + Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1118171860 14:63395952-63395974 GAAGAGGAGGAGAAGGGGGAGGG + Intronic
1118487191 14:66225102-66225124 CCGGAGAACCAGAAGAGGGGTGG - Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1119714004 14:76845344-76845366 AAGGAAAAGAAGAAGGGGAAGGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119749448 14:77067083-77067105 CATGGGAAGCAGAAGAGGGCTGG - Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119812191 14:77531475-77531497 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1119932012 14:78556907-78556929 GAGGAGGAGGGGAAGGGGGAGGG - Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120281453 14:82443663-82443685 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120306762 14:82780818-82780840 AAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1120388359 14:83874009-83874031 CAGAAGGAGCAGACGGGAGAAGG + Intergenic
1120575956 14:86181135-86181157 CAGAAGCAGAAGAAGGGGAAGGG + Intergenic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1120713412 14:87816126-87816148 CATGGGAAGCAGAAGAGGTAGGG - Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121170975 14:91854403-91854425 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1121593270 14:95137180-95137202 AAGGAGAAGGAAAAGGGGAAGGG + Intronic
1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122004710 14:98692636-98692658 CAGGGGAAGGACAAGAGGGAGGG - Intergenic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122347066 14:101067341-101067363 GAGGAGGAGGACAAGGGGGAGGG - Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1122979764 14:105186167-105186189 CCGGAGGAGCAGCAGGGGGCTGG + Intergenic
1123022661 14:105408952-105408974 GAGGAGCAGGAGGAGGGGGAGGG - Intronic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124816784 15:33001703-33001725 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1125547265 15:40515243-40515265 GAGAAGTAGCAGCAGGGGGAGGG - Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127412880 15:58726921-58726943 AAGGAGAAGACGAAGGGGAAGGG + Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128053702 15:64684398-64684420 GAGGAGAAGCTAAAGAGGGAGGG + Exonic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128405716 15:67335736-67335758 CAGGTGAGTCAGAAGGGGAAAGG - Intronic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129839472 15:78734873-78734895 CAGGAGCAGCAGAAGAGGCTGGG + Intergenic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130226059 15:82059034-82059056 GAGGGGGAGGAGAAGGGGGAAGG - Intergenic
1130424965 15:83787820-83787842 AAGGAGAAAGAGGAGGGGGAGGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130744357 15:86635256-86635278 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131017848 15:89072488-89072510 GAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1131284738 15:91047920-91047942 GGGGAGAAGCGGAGGGGGGAAGG - Intergenic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131427725 15:92360546-92360568 CTGGAGGAGCAAATGGGGGAAGG + Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1132026632 15:98409151-98409173 CAGGAGAAGAGGAAGGGGAAGGG + Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132425298 15:101710811-101710833 CAAGAGAAGGAGAGGGGGGTGGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133816313 16:9200010-9200032 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134369489 16:13609760-13609782 GAGCAGGAGCAGATGGGGGAAGG + Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135294714 16:21269326-21269348 CATGAGACGCAGTGGGGGGAAGG + Intronic
1135491139 16:22910787-22910809 CAGGAAAGGTAGAAGGGGAAGGG + Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135727537 16:24868790-24868812 AAGGAGGAGGAGAAGGGTGAAGG - Intronic
1135754325 16:25083799-25083821 CAGGAGAGGAAGAGGGGGGAAGG - Intergenic
1135934800 16:26770611-26770633 GAGGAAAAGGAGAAGAGGGAAGG + Intergenic
1135937522 16:26793671-26793693 GAGAAGGAGCAGAAGAGGGAGGG - Intergenic
1135942452 16:26834310-26834332 GAGAAGAAGAAGGAGGGGGAGGG + Intergenic
1135943554 16:26843665-26843687 CAAAAGAAGCTGAAGGGGGCTGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136074847 16:27809930-27809952 CTGGAGGAGAAGATGGGGGAAGG + Intronic
1136511689 16:30741801-30741823 CAGCAGCAGCGGATGGGGGATGG - Intronic
1136616591 16:31402050-31402072 CAGGAGCTGCAGGAGGGGGTTGG + Intronic
1137004107 16:35256081-35256103 CAGGAGATTCAGGACGGGGAGGG - Intergenic
1137705921 16:50535810-50535832 CAGGAGAGGCAGGAGTGGGGAGG - Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1139717874 16:68828165-68828187 CAGCAGAATCAGAACTGGGATGG - Exonic
1139918813 16:70445903-70445925 AAGGAGAAGGAGAAGGGTAAGGG - Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140209888 16:72961497-72961519 CAGGAGGAGCAGCAGGGGAATGG - Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1141703586 16:85653211-85653233 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1141957560 16:87383158-87383180 CAAGAGAGGCAGACGGGGTAGGG - Intronic
1142137840 16:88459767-88459789 GAGGAGGAGGGGAAGGGGGAGGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142256296 16:89015331-89015353 CAGAAGGACCAGGAGGGGGACGG + Intergenic
1142256312 16:89015383-89015405 CAGGAGGACGAGGAGGGGGATGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142631524 17:1229283-1229305 CCGGAGAAGCCGGCGGGGGAAGG - Intergenic
1142641550 17:1288515-1288537 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641602 17:1288641-1288663 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641670 17:1288786-1288808 GATGAGAAGCTGGAGGGGGATGG - Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143174135 17:4947169-4947191 CAGGAAAAGCAGAAGCGGAGAGG + Intronic
1143224210 17:5286856-5286878 CAGGAGAAAGGGAAGGGGGTGGG + Intronic
1143336077 17:6172508-6172530 GAGAAGAAGCCGAAGAGGGAGGG - Intergenic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143435736 17:6923352-6923374 CAGGAGAAGCAAACTGGGGGAGG + Intronic
1143520414 17:7441185-7441207 CAGCTCAACCAGAAGGGGGAAGG - Intronic
1143542597 17:7578536-7578558 GAGGAGCAGCAGGAGGGGGGAGG + Exonic
1143588335 17:7863730-7863752 CAGGAGTAGGAGTAGGGGGTTGG - Intronic
1143647401 17:8239849-8239871 GAGCAGATGCAGAAGGGGAATGG - Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144746806 17:17621454-17621476 GAGGAGGAGGAGAAGGGGAAGGG + Intergenic
1144746809 17:17621460-17621482 GAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1144838506 17:18171260-18171282 AAGGAGAAGCAAAAGCCGGAGGG - Intronic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146453704 17:32993815-32993837 AAGGAGGAGCAGGAGGGGAACGG + Intronic
1146502113 17:33373040-33373062 TAGGATAAGCAGAAAGGGAATGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146645432 17:34573977-34573999 CAAGAGAAGCATCAGGGGCATGG + Intergenic
1146658853 17:34651428-34651450 CTGGAGGAGCAGAACGGGGCTGG + Intergenic
1146987346 17:37232891-37232913 GAGGAGGAGGACAAGGGGGATGG - Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147036269 17:37683767-37683789 CAGGAGAAGAGGAGGAGGGAGGG + Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147572089 17:41577577-41577599 CAGGAGAAGGACAAAGGGGAGGG + Intergenic
1147599724 17:41738424-41738446 GATGAGAAGCAGGAGAGGGAGGG - Intergenic
1147760589 17:42795313-42795335 CAGGAGCAACGGGAGGGGGAAGG - Exonic
1147970264 17:44215646-44215668 CCGGAGAAGAAGAAGGTGGGGGG - Exonic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148702882 17:49601051-49601073 CAAGTGAGGCAGAAGAGGGAGGG - Intronic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1150335689 17:64329072-64329094 CAGCAGGAGCACAAGGGTGAGGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150628598 17:66859816-66859838 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150851547 17:68708192-68708214 CAGGCGTTGCAGAAGTGGGAGGG - Intergenic
1150964019 17:69947219-69947241 CAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1151001132 17:70377735-70377757 CAAGACAAACAGAAGTGGGATGG + Intergenic
1151153138 17:72105034-72105056 CAGGAGAAGCGGATGGCGGATGG - Intergenic
1151159276 17:72151058-72151080 CGGGAGAGGAGGAAGGGGGAGGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151236034 17:72720335-72720357 CAGGAGTAGAAGCAGTGGGAGGG + Intronic
1151441467 17:74132078-74132100 GAGGAGCAGCAGAAGCGGGAAGG - Intergenic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1151859055 17:76745689-76745711 CAGGAGAAGAGGGAGGGAGATGG - Intronic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152008496 17:77696846-77696868 AAGGAGGAGGAGAAGGGAGAGGG - Intergenic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1154138898 18:11805513-11805535 CAGGAGACTCAAAAGGGTGAGGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1155185502 18:23383529-23383551 CAGGAGCAGCAGAAGGTGACAGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1155449819 18:25951827-25951849 AAGGAGTAGCAGAAGTGGGTAGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156369994 18:36464725-36464747 CAGGAGGAGGCAAAGGGGGAGGG + Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157589683 18:48828908-48828930 GAGGAGGAGCAGGCGGGGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157809101 18:50680554-50680576 CAGGTGATGCTGAAGGGGGATGG - Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1158968248 18:62642571-62642593 CAGGAGGAAAATAAGGGGGAAGG - Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159491502 18:69140749-69140771 CAAGAGAAGAAGAAGGGGGTGGG + Intergenic
1159944016 18:74430196-74430218 CAGGAGAAGCAGAGAAGGGTGGG + Intergenic
1160237675 18:77098955-77098977 GAGGAGAAGAGGGAGGGGGAAGG - Intronic
1160286306 18:77546866-77546888 TAGAAGAAACAGAAGAGGGAGGG - Intergenic
1160429584 18:78802224-78802246 CAGGAGAAAGGGATGGGGGAGGG + Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160761816 19:789291-789313 CAGCAGAGGCAGAATTGGGAGGG - Intergenic
1160965698 19:1746102-1746124 AAGGGGGAGTAGAAGGGGGAAGG + Intergenic
1160979934 19:1812191-1812213 CAGGAGAGGCAGGGGGGGGCAGG + Exonic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1161415776 19:4145593-4145615 GAGGGGAAGGAGAAGAGGGAAGG + Intergenic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1161751717 19:6102577-6102599 AAGGAGAGGCAGAAGAGGCAGGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162690511 19:12426035-12426057 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1162818114 19:13208158-13208180 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163166278 19:15500232-15500254 GAAGAGAAGAAGAAGGGTGAAGG - Intergenic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163235660 19:16029093-16029115 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164335919 19:24321266-24321288 AAGGAGTAGCTGAAGGGAGAGGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164730028 19:30496626-30496648 CAGCAGAGGCAGTTGGGGGAAGG + Intronic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1165388121 19:35523611-35523633 CGGGAGAAGCACAAGGGGACTGG + Intronic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166008621 19:39925123-39925145 AAGAAGAAGAAGAAGAGGGAAGG + Intronic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166322499 19:42027337-42027359 CAGGAGAAGACCTAGGGGGAAGG + Intronic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1166329581 19:42070216-42070238 CAGGAGAGAGAGAAGAGGGAGGG + Intronic
1166347964 19:42178047-42178069 GAGGAAAAGGAGAAGGGAGAGGG + Intronic
1166387514 19:42390435-42390457 CAGGAGGAGAAGTGGGGGGATGG - Intergenic
1166395053 19:42433530-42433552 CAGGAAAAGGATAAGGGGCAGGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674944 19:44734651-44734673 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167299549 19:48670954-48670976 CAGGAGGAGCAGGAGGGCAAAGG + Exonic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167440676 19:49507018-49507040 GAGGGGAAGGAGAAGGGGAAGGG - Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167702104 19:51054950-51054972 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167775643 19:51553004-51553026 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1168030948 19:53679274-53679296 CAAGAGAAAAAAAAGGGGGAGGG - Intergenic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
925496212 2:4452461-4452483 GAGGAGGAGGGGAAGGGGGAAGG - Intergenic
925548288 2:5041746-5041768 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
925669996 2:6301132-6301154 CAGAAGAAGCACATGTGGGAAGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926309012 2:11661016-11661038 GAGTAGAAGCAGGAGAGGGAAGG - Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926724118 2:15984255-15984277 CTGGAGAAGCAAGAGGGAGAAGG - Intergenic
926807668 2:16726201-16726223 CAGAAGAATCAGAAGAGGCAAGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926909959 2:17843361-17843383 CATGAGAAGAAGACGGGAGAGGG + Intergenic
927067828 2:19491762-19491784 GAAGAGAAACAGAAGAGGGAGGG + Intergenic
927186495 2:20486089-20486111 GAGGAGAAGAAGAAGAGAGAGGG + Intergenic
927287480 2:21371607-21371629 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
927302410 2:21530724-21530746 AAGGAGAAGGAGAAGGCGAAGGG - Intergenic
927400890 2:22708390-22708412 CAGGAGAAGGAGAAGTGAGTGGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927866174 2:26589147-26589169 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
927930359 2:27039861-27039883 GAGGAGAGGCAGAAGAGAGAAGG + Intronic
928105838 2:28470082-28470104 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
928108444 2:28488178-28488200 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
928268262 2:29831040-29831062 GAGGAGAAGGAGAAGAGGAAGGG + Intronic
929347230 2:40899666-40899688 AAGGAGAAGCATCAGGGGTAAGG - Intergenic
929481229 2:42310323-42310345 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929593841 2:43163335-43163357 CAGGAGAGGCAGAGAAGGGAGGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929869499 2:45746347-45746369 CAGGAGGAGCAGATTTGGGAAGG - Intronic
930140911 2:47950581-47950603 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930768413 2:55108397-55108419 CAGGAGAGGGAGAAGGGTGAAGG + Intronic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931205343 2:60140846-60140868 GAGGAGGAGAAGGAGGGGGAGGG - Intergenic
931330080 2:61271689-61271711 AAGGAGGGGAAGAAGGGGGAAGG + Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931502203 2:62881461-62881483 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
931902759 2:66807550-66807572 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
931975350 2:67637996-67638018 GAGGAGGAGTAGAAGAGGGAGGG + Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
933072860 2:77883183-77883205 CAGGAGAAGGAATAGAGGGATGG - Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
933441103 2:82315394-82315416 GAGGAGAAGGAAGAGGGGGAGGG - Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935326554 2:101942928-101942950 CAAGAGAACCAGAAGGGAAAAGG + Intergenic
935844714 2:107153345-107153367 CAGCAGATGCGGAAGGGTGAAGG - Intergenic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936985507 2:118308677-118308699 GAGGAGTAGGAGAAGAGGGAGGG + Intergenic
937130902 2:119512328-119512350 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937313696 2:120917685-120917707 CAGGAGAAGCCCAAGGCAGAAGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937686814 2:124706853-124706875 GAGGAGAAGGAGAAGGGGAAAGG + Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938043410 2:128095377-128095399 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
938043413 2:128095383-128095405 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938443414 2:131355910-131355932 GAGGAGGAGGAGAAGGGGAAGGG - Intergenic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
938729378 2:134134468-134134490 CAGGAAAAGCAGAATAGGCAGGG - Intronic
938742444 2:134245601-134245623 AAGGAGAAGCAGAGGAGGAAGGG - Intronic
939024194 2:136992486-136992508 CAGGAAAAGCCTATGGGGGATGG + Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
940216135 2:151305402-151305424 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941234024 2:162946629-162946651 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
941234027 2:162946635-162946657 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941712752 2:168731615-168731637 AAGGAGAAGTAGCAGGGGGTGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942357998 2:175140477-175140499 CAGGAGTAGAAGGAGTGGGAGGG + Intronic
942538211 2:176988023-176988045 CAGGGGATGCAGAAGAGAGAAGG - Intergenic
942602801 2:177658454-177658476 GAGGAGAGGCAGAGGAGGGAAGG - Intronic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943921535 2:193713263-193713285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945188793 2:207166077-207166099 CAGGAGGAGGAGAAAAGGGAGGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946762720 2:223010962-223010984 CAGGAAAAGTGGAAGTGGGAGGG + Intergenic
946857670 2:223968899-223968921 GAGGAGGAGGAAAAGGGGGATGG - Intergenic
946993640 2:225365159-225365181 GAGGAGAAGCAGCAGGGGTGAGG - Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
948344335 2:237282673-237282695 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948344349 2:237282703-237282725 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948538967 2:238672217-238672239 GAGGAGAAGGAGGAGGGGGGAGG - Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558565 2:238835263-238835285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558568 2:238835269-238835291 AGGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558591 2:238835344-238835366 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
948805820 2:240453188-240453210 CAGGAGGGGCGGAAAGGGGATGG - Intronic
948844393 2:240676275-240676297 CAGAAGAAGCAGGAGAGGAAAGG - Intergenic
948849465 2:240698604-240698626 CAGAAGAAGCAGGAGAGGAAAGG + Intergenic
948923806 2:241081385-241081407 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948939253 2:241187931-241187953 GAGGAGAAGGAGGAGAGGGAAGG + Intergenic
949047705 2:241879659-241879681 CAGGAGAGGCAGCAGAGGGCTGG + Intergenic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1169130988 20:3166364-3166386 CAGGAAACGCAGGAGGGGGCTGG + Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169461196 20:5797160-5797182 AAGGAAAAACAAAAGGGGGAAGG + Intronic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169655244 20:7915359-7915381 AAGGAGAAGAAGAAGGGAAAGGG + Intronic
1169765574 20:9144661-9144683 AAGGAGGAGGAGGAGGGGGAAGG + Intronic
1170451583 20:16489249-16489271 TAGGCGAGGCTGAAGGGGGAGGG + Intronic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1170579241 20:17685250-17685272 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172444980 20:34988176-34988198 CAGGAGGAGTACAAGCGGGAGGG + Exonic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172484649 20:35291053-35291075 CAGGAGAAAGAGAATTGGGAGGG - Intronic
1172806181 20:37613460-37613482 GAGGAGAAGCAAAAGAGTGAGGG - Intergenic
1172811258 20:37649945-37649967 AAGGAAAAGAAGAAGGGAGAAGG + Intergenic
1172895235 20:38295553-38295575 GATGTGAAGCAGAGGGGGGATGG + Intronic
1172993199 20:39050761-39050783 CAGGAGAAGCAGATGGGCCATGG + Intergenic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173678246 20:44856968-44856990 GAGGAGAAGAAGAAGGGGAGGGG + Intergenic
1173775128 20:45698985-45699007 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
1174150375 20:48482158-48482180 GAGGAGGAGGAGCAGGGGGAAGG + Intergenic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1174554003 20:51381157-51381179 GAGGACAGGCAGAAGGGGAAAGG + Intergenic
1174582595 20:51582714-51582736 CAGGAGAACCAGCCGTGGGAGGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174649318 20:52111075-52111097 CAGGAGAAGGGGAAGCGGCAGGG + Intronic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174709522 20:52690257-52690279 AAGGGGAAGGAGAAGGGGAAAGG - Intergenic
1174794468 20:53510697-53510719 TAGGGGAAGCTGAAGGGTGAGGG - Intergenic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175073392 20:56353616-56353638 CAGGAGCAGCAGGAGGGGGTGGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175547401 20:59787354-59787376 GAGGAGGAGCAGAGGTGGGAGGG + Intronic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177012470 21:15745050-15745072 CAGGAAAAGAAGGAGTGGGAAGG - Intronic
1177042779 21:16133450-16133472 CACGAGAAGCACAAGGGGTTGGG - Intergenic
1177114866 21:17073349-17073371 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1177114869 21:17073355-17073377 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1177177128 21:17712299-17712321 GAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1177507230 21:22034750-22034772 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178584721 21:33862480-33862502 TGGGAGAAGGAGAAGAGGGAAGG + Intronic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178799491 21:35779164-35779186 GAGGAGAAGGGGAAGCGGGAGGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179224650 21:39442991-39443013 CAGGAAAAGCAGAAGAGTCAGGG + Intronic
1179439477 21:41382971-41382993 CAGGAGAGGCACAGGGGTGAGGG + Intronic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180699312 22:17773139-17773161 CAAGAGGGGCAGAAGGGGCAGGG + Intronic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1181960164 22:26617045-26617067 CAGAGGAAGCAGACGGGGAAAGG - Intronic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182122098 22:27794890-27794912 GATGAGAAGGGGAAGGGGGAGGG + Intronic
1182308528 22:29388375-29388397 CAGGAGAAGAAGTGGGGCGAGGG - Intronic
1182372287 22:29819720-29819742 CAGCAGCAGGAGACGGGGGAGGG - Intronic
1182408347 22:30158566-30158588 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182841207 22:33391419-33391441 CAGGGGAAGCATTAGGGGAAGGG + Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183414243 22:37673497-37673519 CAGCAGTTTCAGAAGGGGGACGG + Intergenic
1183481165 22:38066333-38066355 GAGGAGATGCGGAGGGGGGAAGG - Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1184205746 22:43001489-43001511 CAGAAGAAGCAGGACTGGGAGGG + Intronic
1184394691 22:44226212-44226234 CAGGAGAAAGTGAAGGGGGGTGG - Intergenic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184656837 22:45946185-45946207 CAGGAGAGGCTGGAGGGTGAGGG - Intronic
1184695629 22:46137405-46137427 CAGGAGGAGGAGTCGGGGGAGGG - Intergenic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949833610 3:8244109-8244131 CAGGAAAAGGGGAAGGGAGAAGG + Intergenic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
951449506 3:22820343-22820365 CAAGAGCAGCACTAGGGGGATGG + Intergenic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952276898 3:31886029-31886051 AAGGAGAAGGAGATGGGGGGTGG + Intronic
952726824 3:36595308-36595330 AAGGAGAAGGAGAAAGGGAAGGG - Intergenic
953150147 3:40317198-40317220 CAGAAGAAATTGAAGGGGGACGG + Intergenic
953285474 3:41602383-41602405 AAGGAGAATTGGAAGGGGGAAGG + Intronic
953313841 3:41907402-41907424 CATGGGAAGCTGAAGTGGGAGGG - Intronic
953450562 3:43001842-43001864 CAGGAGAAGGGGAAGGGGTGAGG - Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954157547 3:48694951-48694973 GAGGAGAAGGAGGAGAGGGAGGG + Intronic
954634363 3:52063581-52063603 CAGGACGAGGAGAAGAGGGAGGG - Intergenic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
955087823 3:55720098-55720120 GAGGAGGAGGAGGAGGGGGATGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955719972 3:61870000-61870022 GAGGACAAGTCGAAGGGGGAGGG - Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
957178286 3:76841500-76841522 CAGGAAAAATAAAAGGGGGAGGG - Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
959240909 3:103792500-103792522 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959695184 3:109241534-109241556 CAGGGGAAGAAGAAGGGTGGGGG + Intergenic
959963814 3:112332219-112332241 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960062824 3:113340902-113340924 TGGGAGAACCAGAAGGGAGATGG + Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960303714 3:116035455-116035477 CAAGAGAAGGAAAAGGGGGTGGG + Intronic
960529921 3:118753013-118753035 GAGGAGAAGGAGAAAGGAGAAGG + Intergenic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
960734756 3:120766573-120766595 AAGGAGAAGATGAAGGGGTAAGG - Intronic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
961203676 3:125063853-125063875 GAGAAGAAACAGAAGAGGGAAGG - Intergenic
961372584 3:126440630-126440652 CAGGAGCAGGGGCAGGGGGAGGG - Intronic
961449815 3:126997623-126997645 CAGGAGAGGCGGAAAGGGGGCGG - Intronic
961487512 3:127227270-127227292 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
961508019 3:127384229-127384251 CAGGAGGAGGAGGTGGGGGAGGG + Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962381204 3:134899426-134899448 CAGAAGAAACAGCAGGGCGAAGG - Intronic
962425449 3:135265424-135265446 CAAGAGCAGCAGAAGGGAAAGGG + Intergenic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
963065028 3:141256842-141256864 GAGGAGAGCCAGAAGTGGGAGGG + Intronic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
963405378 3:144856620-144856642 GAGGAGAAGGGGGAGGGGGAGGG - Intergenic
963646125 3:147917000-147917022 TAAGAGAAGAAGAAGGGAGAAGG - Intergenic
963836831 3:150066696-150066718 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
964548930 3:157865479-157865501 CTGGAGAAGCAGCAGGGCCAGGG - Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964568139 3:158080881-158080903 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
964576047 3:158169667-158169689 CAAGAGAAGCAGATGGGGTTAGG - Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966542286 3:181105625-181105647 CAGGAGATACAAAAGGCGGATGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
966954742 3:184864126-184864148 AAGGAGAAGGAGAAGGGAGGGGG + Intronic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967332819 3:188308960-188308982 GAGGAGAAGGAGAAAGGAGAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967997081 3:195174766-195174788 AAGGAGAAGGAGAAGAGGAAGGG - Intronic
968131001 3:196192770-196192792 CAGGAGGAGGAGCAAGGGGAAGG + Intergenic
968135629 3:196217639-196217661 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
968148515 3:196319243-196319265 CAGGAGAGGCTGAAAGGGCAGGG + Intronic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969111889 4:4849491-4849513 CAGGAGAAGCTAGAGGGGGTTGG + Intergenic
969122615 4:4921080-4921102 CAGGTGAAGAAGATGGGGAAAGG - Intergenic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969617125 4:8260183-8260205 GAGGAGGAGCAGGAGAGGGAAGG - Intergenic
969671037 4:8590568-8590590 CAGGTGAGGCAGGAGGGCGAGGG - Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
969853103 4:9977551-9977573 CAGGAGCAGGGGGAGGGGGAGGG - Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
969979531 4:11140488-11140510 GAGGAGAAGGAGGAGGGGAAGGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970645295 4:18113826-18113848 GAGGAGAAGAAGAAGGGGAAGGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971265279 4:25091444-25091466 CAGGGGAGGAAGAAGGGGCAGGG - Intergenic
971265632 4:25094130-25094152 GATGAGAAGCAGAGGAGGGAAGG - Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
971305120 4:25473301-25473323 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
973288023 4:48441140-48441162 CAGGAGAAGGAGAAGTGCGTGGG - Intergenic
973655610 4:53044581-53044603 AAGGAGAAAGAGAAGGGGAATGG - Intronic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974214953 4:58832991-58833013 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974753775 4:66176790-66176812 AAGGAGAAGGAGAAGGGAAAGGG + Intergenic
975160944 4:71122744-71122766 AAGGAGATGCCGAGGGGGGATGG - Intergenic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
975362362 4:73485704-73485726 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
977830945 4:101592054-101592076 CAGGACAGGCAACAGGGGGAAGG - Intronic
978150810 4:105432587-105432609 CAGTAGAGGCAGAAGGGGATAGG + Intronic
978268530 4:106858866-106858888 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
978702311 4:111662595-111662617 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
979367020 4:119837429-119837451 AAGGAGAAGGGGATGGGGGAGGG + Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981498716 4:145423119-145423141 GAGGAGGAGAAGAAAGGGGAGGG + Intergenic
981733243 4:147922013-147922035 CAGGAGGTGCAGGAGGGGCAGGG - Intronic
981805144 4:148706820-148706842 CAGGAGAACAGCAAGGGGGAAGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982312872 4:154003969-154003991 GAGGAGAAGGGGAAGGGGCAGGG + Intergenic
982364369 4:154559185-154559207 GAGGAGAAGAAGAAGGGGAAGGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982977968 4:162090960-162090982 CATGAGGAGCAGAAAGGTGATGG - Intronic
983034793 4:162850235-162850257 CAGGACCAGAAGAAGGGAGAGGG + Intergenic
983189330 4:164738478-164738500 CAGGAGAAGAGGAGGAGGGAAGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983738222 4:171090733-171090755 TAGGATAAGCAGGAGGGGGCTGG - Intergenic
984070309 4:175103264-175103286 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984725159 4:183013444-183013466 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984734474 4:183098008-183098030 CAGAAGAAGATGACGGGGGACGG + Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985140940 4:186840379-186840401 AAGGAGGAGAAGGAGGGGGAGGG - Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985690117 5:1304258-1304280 GAGGAGAAGTGGAAGGGGAAGGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
985774119 5:1831787-1831809 CAGGAGGAGGAGCCGGGGGAAGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986123161 5:4861043-4861065 CAGGAGAAGCAATAGGTGAAAGG + Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986605881 5:9522290-9522312 GAGGAGAAGTAGGAGGGGAACGG + Intronic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986782718 5:11081816-11081838 CAGGGGCTGGAGAAGGGGGATGG + Intronic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986946669 5:13029303-13029325 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
986946681 5:13029336-13029358 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987772212 5:22319940-22319962 CGGGAGCAGGAGAAGGGAGATGG + Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988632079 5:32942330-32942352 AAGGAGAAGGAGAAGGGAGGAGG + Intergenic
988862896 5:35303326-35303348 CAGAAGAAGCAGGAGGGGTGGGG + Intergenic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
989307983 5:39979736-39979758 CAGCAGAAGATGAAGAGGGAGGG - Intergenic
989479056 5:41907077-41907099 CAGGAGATGGTGAAGGCGGAGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989692360 5:44159299-44159321 CAGGAGGAAGATAAGGGGGAGGG + Intergenic
989709315 5:44378141-44378163 CAACAGCAGCTGAAGGGGGATGG + Intronic
990276398 5:54201594-54201616 AAGAAGAAGCATAAGGGGTAAGG - Intronic
990276814 5:54205956-54205978 CAGAAGAAGAATAAGGGGGAAGG - Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990719617 5:58679174-58679196 AAGGAGAAGCAGCAGGGTGGGGG + Intronic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991288109 5:65003389-65003411 TAGGAGAAGAAGAAAGGGAAGGG - Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991386603 5:66097607-66097629 CAAGTGAAGTAGATGGGGGAAGG + Intergenic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
992967677 5:82019943-82019965 CAGCAGTTGTAGAAGGGGGATGG + Intronic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993622556 5:90186160-90186182 GAGGAGGAGGAGAGGGGGGAAGG - Intergenic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
993716132 5:91277361-91277383 GAGGAGAAGGGGGAGGGGGAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994456149 5:100010684-100010706 CAGGAAAAAAAAAAGGGGGACGG + Intergenic
994541298 5:101101643-101101665 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
994641882 5:102420998-102421020 CCCGAGAAGCAGAAGGGGCTGGG + Intronic
994850269 5:105046311-105046333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
995918749 5:117284463-117284485 CAGGAGAAGCAGGCCGGGCACGG - Intergenic
996330193 5:122320039-122320061 CAAGAGAAGCTGAAGGCTGAGGG - Intronic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996387587 5:122925226-122925248 GAGGAGAAAAAGAAGAGGGAGGG - Intronic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996992458 5:129651431-129651453 CAGGAGAAGTTAAAGGGGGCAGG - Intronic
997192067 5:131946425-131946447 GAGGAGAAGGGGAAGGGGAAGGG - Intronic
997413546 5:133708110-133708132 GAAGAGAAAGAGAAGGGGGAGGG + Intergenic
997465699 5:134086695-134086717 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
997719453 5:136065952-136065974 AAGGAGAGGAAGAAGGGGAATGG + Intergenic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998189495 5:140011006-140011028 CAGGACAAACAGTAGTGGGAGGG - Intronic
998192758 5:140041850-140041872 CAGGAGAGGAAGGAGGGGGCGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998549864 5:143067035-143067057 AAGCAGAAGCGGGAGGGGGAGGG - Intronic
998660690 5:144233860-144233882 AAGGAGAGGGAGAAGAGGGAGGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998823847 5:146081521-146081543 CAGAAGAAGCAAAAGGGGAAAGG + Exonic
998929319 5:147163144-147163166 AAGGAAGAGAAGAAGGGGGAAGG - Intergenic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000068938 5:157721122-157721144 CATGGGAAGCAGAAGGGGTCAGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000811159 5:165863653-165863675 AAGGAGAAGCAGAAGGGATCTGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001189547 5:169615697-169615719 CAGGAGAGGGAGAAGAGTGAAGG - Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001706056 5:173741782-173741804 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1001737792 5:174021029-174021051 GAGGAGGAGGAGAAGGGGAAGGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001810941 5:174627772-174627794 CAGGTGGAGCTGAAGTGGGACGG + Intergenic
1002173679 5:177389372-177389394 CACAAGAAGCAGCAAGGGGAAGG - Intronic
1002786361 6:403269-403291 CAGGAGATGCTGACAGGGGAGGG - Intronic
1002847227 6:957670-957692 CAGGATAGGCTGAAGGGGGCAGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002941529 6:1720804-1720826 CAGAAGGAGCAGGAGCGGGAGGG + Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003559684 6:7170399-7170421 CAGGAGCAGCAGAGAGGTGAGGG + Intronic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1004119672 6:12808828-12808850 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1004755630 6:18607737-18607759 CAAGAGAGGAAGAAGGGAGAAGG + Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005211641 6:23472245-23472267 CAGGTGAAGTAGAAGGAGTATGG + Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005496657 6:26393382-26393404 CAGGACCACCAGAAGGGAGAGGG + Exonic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1005891360 6:30141493-30141515 CAGGAGAAAAACAAGGGGAATGG + Intronic
1006154709 6:32007919-32007941 CCGGAGATGCTGAAGGGGGCTGG - Intergenic
1006161021 6:32040654-32040676 CCGGAGATGCTGAAGGGGGCTGG - Exonic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006459282 6:34148940-34148962 CAGGGGAAGGGGAAGGGTGAAGG + Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006535490 6:34696213-34696235 CAGGAGGGGCGGAAGGGAGATGG - Intronic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006567766 6:34974211-34974233 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007183941 6:39951451-39951473 CAGGAGAAACAGCAGGGATATGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007368864 6:41413275-41413297 CAGCAGCAGCAGAACTGGGAAGG - Intergenic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008016429 6:46525630-46525652 AAGGAAGAGAAGAAGGGGGAGGG + Intergenic
1008111245 6:47497356-47497378 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1008294903 6:49763668-49763690 AAGGAGAAGTTGAAGGGGTAAGG - Intergenic
1008369232 6:50714441-50714463 CAGTAGATGCACAAGGGGGATGG + Intronic
1008479294 6:51968383-51968405 CAGGAAAAGAAGAAAAGGGAGGG - Intronic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010613919 6:77990493-77990515 CAGGAGAGCCGGAAAGGGGAGGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010887421 6:81261880-81261902 GAGGGGAAGAGGAAGGGGGAGGG + Intergenic
1010985136 6:82414855-82414877 CTGGAGGAGCAGCAGTGGGAGGG + Intergenic
1011221430 6:85058315-85058337 CAGAAGAAGCAGAAGGGCTTGGG + Intergenic
1011255644 6:85418148-85418170 CAGGAGAACCAGAAGTGCTAAGG + Intergenic
1011305601 6:85922977-85922999 AAGGAGATGAAGAAGGGGGCGGG - Intergenic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011407142 6:87027849-87027871 CAAGAGAAGCAGAAAGGAAATGG + Intergenic
1011702909 6:89972104-89972126 CAGGAGCAGCAGCTGGGGCAAGG + Intronic
1011714873 6:90094785-90094807 CAGGGGAACCAGAAGTGGCATGG - Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013073756 6:106752375-106752397 CAGGAGACACAGCAGAGGGATGG - Intergenic
1013075594 6:106768296-106768318 CAAGAAGAGCAGAAGAGGGAAGG + Intergenic
1013853472 6:114543079-114543101 CAGGGGCTGGAGAAGGGGGATGG - Intergenic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015997885 6:139013621-139013643 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1016088326 6:139943586-139943608 CATCAGAATCAGAAGGGGGTGGG + Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016358368 6:143242103-143242125 GAGGAAAAGCAGTAGGGAGAAGG + Intronic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1016865182 6:148759205-148759227 CAGGAGAGGGAGAAAGGGCATGG + Intronic
1017166320 6:151411486-151411508 CAGTAGAGGCAGAAGGGGCTTGG + Intronic
1017192208 6:151666690-151666712 GAGGAGGAGGAGGAGGGGGATGG - Intronic
1017237323 6:152130172-152130194 TAGGATAAGCAGAAGAGAGAAGG + Intronic
1017339565 6:153305195-153305217 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339615 6:153305369-153305391 AAGGAGGAGGAGAAGGGGAAGGG - Intergenic
1017437439 6:154429707-154429729 GAGGAGGAGGAGACGGGGGAGGG - Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018042098 6:159933830-159933852 CAGGGGAAGCTGATGGGGAATGG + Intergenic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018220202 6:161570495-161570517 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018547353 6:164952345-164952367 CAGAAGTGGCAGAAGGTGGAAGG - Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019535276 7:1526114-1526136 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535300 7:1526201-1526223 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535324 7:1526287-1526309 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535356 7:1526402-1526424 AAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019559703 7:1649895-1649917 CAGGAGAGGTAGAGGGGAGATGG + Intergenic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019891998 7:3954488-3954510 GAGGAGAAGCAGGAGGGGAGGGG - Intronic
1019914952 7:4126984-4127006 CAGGAGAAGCTGAAGAGAGAAGG - Intronic
1019959823 7:4449798-4449820 CAGCAGCAGGAGCAGGGGGAAGG - Intergenic
1020410714 7:7888870-7888892 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020954126 7:14718635-14718657 CAGGAGAAGTAGTCCGGGGAGGG + Exonic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022274423 7:28841817-28841839 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022274426 7:28841823-28841845 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022357052 7:29625786-29625808 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022357055 7:29625792-29625814 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022500153 7:30877654-30877676 AAGAAGAAGAAGAAGAGGGAAGG - Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022901235 7:34812436-34812458 TAGGAGATGCTGAAGTGGGATGG + Intronic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023885278 7:44349638-44349660 CAGGAGCAGCTGAGGGGGCAGGG - Intergenic
1023892496 7:44403246-44403268 CAGGAGAGTCAGAACTGGGATGG + Intronic
1024312155 7:47979375-47979397 CAGGAGGATCAGAACGGGGATGG - Intronic
1024385680 7:48748795-48748817 CAGGCGAAGCAGCATGGGGGAGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024599020 7:50963311-50963333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026241727 7:68581429-68581451 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1026360787 7:69599464-69599486 GAGGAGAAAGAAAAGGGGGAAGG - Exonic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1027532344 7:79352527-79352549 AAGCAGAAGCATGAGGGGGAAGG + Intronic
1027814708 7:82953701-82953723 GAGGAGGAGGAGGAGGGGGAGGG + Exonic
1028070828 7:86448038-86448060 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1028308025 7:89290649-89290671 AAGGAGAGGTAAAAGGGGGAAGG + Intronic
1028611524 7:92717368-92717390 AAGGGGAAGGAGAAGGGGAAAGG + Intronic
1028966467 7:96807204-96807226 GAGGAGAAAGTGAAGGGGGAAGG + Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029254467 7:99260248-99260270 CAGGAGGAGTACAAGAGGGAAGG + Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029441381 7:100588648-100588670 CAGGAGAAACAGCAGGGGTCAGG - Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030257456 7:107526871-107526893 CAGGACTAGCAGAAGCGGGTAGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030727391 7:112941077-112941099 CAGGAGAAGCGGGAGGTGAAGGG + Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031865989 7:127039624-127039646 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1031865992 7:127039630-127039652 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032329270 7:130962540-130962562 CAGGAGGAAGATAAGGGGGAAGG - Intergenic
1032515033 7:132500461-132500483 GAGAAGAAGAAGGAGGGGGAGGG + Intronic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032911774 7:136440513-136440535 CAGGAGACAGAGAAGAGGGAGGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033018753 7:137699781-137699803 CAGGTGAAATTGAAGGGGGAAGG - Intronic
1033215108 7:139487686-139487708 GAGGTGAAGGGGAAGGGGGAGGG + Intergenic
1033359198 7:140626234-140626256 CAGGGGACGGAGAAGGGGAAGGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033804324 7:144937416-144937438 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033935739 7:146583439-146583461 CATGAGAATCTGAAGGGAGAAGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034257492 7:149732671-149732693 GAGTAAAAGCAGAAGGGGGTGGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1034491732 7:151396487-151396509 CAGGAGCAGCGGGAAGGGGATGG + Intronic
1034562507 7:151890311-151890333 CAGGAGAAGGAGCAGAGGAAGGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1034944917 7:155255646-155255668 AAGAAGAAGAAGAAGGGGAAAGG + Intergenic
1035027485 7:155835605-155835627 CAGGCGAGGCCCAAGGGGGATGG + Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035516769 8:240376-240398 GAGGACCAGCAGAAGGGAGAAGG + Intronic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1036193120 8:6689536-6689558 GAGGAAAAGAAGAAGAGGGATGG - Intergenic
1036256123 8:7208131-7208153 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036361361 8:8079368-8079390 CAGGTGAAGAAGCAGGGAGAGGG - Intergenic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1036453704 8:8891356-8891378 CAGGAGAAGCACGACGCGGAGGG - Exonic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1036718038 8:11144888-11144910 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1036718041 8:11144894-11144916 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1036763850 8:11533616-11533638 GAGGAGTAGGAGGAGGGGGAAGG + Intronic
1036889613 8:12587655-12587677 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037218216 8:16484057-16484079 AAGGAGAAGAAGAAAGGGTAGGG + Intronic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037754682 8:21703249-21703271 AAGGAGAAAAAGAAGGGGGTGGG + Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037987546 8:23299291-23299313 GAAGAGAAGCAGAAGGGTGCAGG + Intronic
1038269793 8:26065945-26065967 CAGGAGAGACTGTAGGGGGATGG - Intergenic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1039435988 8:37559566-37559588 GAGGAAAAGAAGGAGGGGGAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039576138 8:38625513-38625535 CAGGAGGAGAAGAAGGGCAATGG + Intergenic
1039588658 8:38728607-38728629 CAGGTGGCGCAGAAGGGAGAGGG + Intronic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039691304 8:39867669-39867691 GAGAAGAAGAAGGAGGGGGAAGG - Intergenic
1039751902 8:40486341-40486363 GAGGAGAAGGAGAAGAGGAAGGG - Intergenic
1039912305 8:41834943-41834965 CGGGAGAAGCTGGAGGGGCAGGG + Intronic
1039979273 8:42392395-42392417 CAGGAGACGCAGACGGGGAAAGG - Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1042070847 8:64931503-64931525 CAAGAGAAGCACAAGGGGTCAGG - Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1043310080 8:78847938-78847960 CAGCAGAAGCAGGTGGGGGGGGG + Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044402234 8:91786155-91786177 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044531427 8:93311931-93311953 CAGAAGAAGCACATGGGAGAAGG + Intergenic
1044595568 8:93955223-93955245 AAGGAGAAGCAGAGGTGAGAGGG - Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044958424 8:97505590-97505612 CAAGTGAAGCAAAAGAGGGAGGG + Intergenic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047523724 8:125615286-125615308 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1047523727 8:125615292-125615314 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1047537346 8:125731957-125731979 CTGGAGACGGAGACGGGGGAGGG + Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047624779 8:126645507-126645529 CAGGAAGAGCAGGAGAGGGAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047916650 8:129591150-129591172 GAGGAGAAGCACAGGAGGGAGGG + Intergenic
1047980826 8:130180058-130180080 GAGGAGAAGGGGAAGGGGAAGGG + Intronic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048417559 8:134243633-134243655 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048417576 8:134243693-134243715 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048516580 8:135116818-135116840 GAGGAGGAGGAGAGGGGGGAGGG - Intergenic
1048517449 8:135123800-135123822 CAGGAGAAGAAGGAAAGGGAAGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1049190722 8:141285949-141285971 CAGGAGAACCAGCAGCGTGAAGG + Intronic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049582910 8:143420887-143420909 CAGCAGGAACAGAAGGGTGAGGG + Intronic
1049840385 8:144767317-144767339 CATGGGAAGCAGAGGTGGGAGGG - Intergenic
1050262986 9:3860604-3860626 CAGGAGAAGCAGATGGGCAAAGG + Intronic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1050358550 9:4805396-4805418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1050575831 9:6994311-6994333 GAAGAAAAGCAGCAGGGGGAGGG - Intronic
1050606154 9:7303525-7303547 AAGGAGAGGAAGAAGGGAGAGGG + Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1051012558 9:12436252-12436274 CAAAAGACTCAGAAGGGGGAAGG - Intergenic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1051868832 9:21713748-21713770 TAAGAGAAGCAAAGGGGGGAGGG + Intergenic
1051886572 9:21899396-21899418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052738437 9:32369654-32369676 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052976789 9:34417051-34417073 AAGGAGAAGGGGAAGGGGAAAGG - Intronic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1052997163 9:34557249-34557271 CAGAACATGCAGCAGGGGGAAGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053415533 9:37944834-37944856 CAGGAGAAGCTGCAGGGAGAAGG - Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053840067 9:42183506-42183528 GAGGTGCAGCAGGAGGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054728423 9:68676292-68676314 CAGGAGAGGAAGCAGGTGGATGG - Intergenic
1054743088 9:68828200-68828222 CAGGAGAAACAGAAGAGGAAGGG - Intronic
1054862988 9:69972250-69972272 CAGGAGTAACAGAGGGGGAAGGG - Intergenic
1054907139 9:70421172-70421194 CAGGAGGAGAGGAAGGGGGAGGG - Intergenic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056244483 9:84680665-84680687 CAGGAGCAGAAGGAGAGGGAGGG - Intronic
1056546840 9:87620548-87620570 GAAGAGAAGGAGTAGGGGGAGGG + Intronic
1057010999 9:91601162-91601184 CAGGTGAAGCTGAGTGGGGACGG - Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058444581 9:105043437-105043459 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1059507265 9:114810967-114810989 CAAGAGAACCAGATGGGGGGAGG - Intergenic
1059528668 9:115016151-115016173 CAGGAGAGGCAGAAGGCAAAAGG - Intergenic
1059691240 9:116687591-116687613 GAGGAGATGCAGCTGGGGGAGGG + Intronic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060283520 9:122228973-122228995 GAGGAGAAGAAGGAGGGGGCGGG - Intronic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1060830263 9:126709346-126709368 CAGGAGAAGCAGGAAGGAGCAGG + Intergenic
1061360437 9:130138492-130138514 GAGGAGGAGCGGAAGGGGAAGGG - Exonic
1061366901 9:130176941-130176963 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
1061899691 9:133666542-133666564 AAGGAGGAGAAGGAGGGGGAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062325627 9:136011160-136011182 CAGGAGGAGCAGGAAGGGCAGGG + Exonic
1062469704 9:136697007-136697029 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062638360 9:137503426-137503448 AAGGAGAATGAGGAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1185499133 X:584281-584303 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
1185499161 X:584381-584403 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1185688325 X:1948435-1948457 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1185688603 X:2133957-2133979 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186471160 X:9823075-9823097 AAGGAGGAGGAGAAGGGAGAAGG - Intronic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186689708 X:11962329-11962351 CAGGAAGAGCAGAAGGGAAAAGG + Intergenic
1187200592 X:17130310-17130332 CAGGAGAAGCAGGAGTGAGGGGG - Intronic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1188338932 X:28975246-28975268 CAAGAGTTGCAGAAGGGGCAGGG - Intronic
1188724276 X:33562286-33562308 GAAGAGGAGCAGGAGGGGGAGGG - Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1189684401 X:43548820-43548842 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189777104 X:44480263-44480285 CAGGAGAAGCAAAAGATGGGAGG - Intergenic
1190274108 X:48889420-48889442 CAGGAGGAGCAAAAGGGAGACGG - Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190561950 X:51694980-51695002 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1190561953 X:51694986-51695008 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1190879728 X:54483723-54483745 GAGGAGAAGCAGACCGGGGCTGG - Intronic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192190060 X:68985571-68985593 GAGGAGAAGGACAGGGGGGAAGG + Intergenic
1192448953 X:71230885-71230907 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193979893 X:88169144-88169166 CTGGAGAAGCAGTTAGGGGAGGG + Intergenic
1194494682 X:94599912-94599934 CAGGAAATGCACAAGGGGAAAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195067505 X:101250817-101250839 CAGGAGAACCAGCAGGGGCTGGG - Intronic
1195273324 X:103254414-103254436 TAAGAGACGCTGAAGGGGGAGGG - Intronic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195635830 X:107114925-107114947 CAGGAGTAGAAGAAGTGGCAGGG - Intronic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic
1195696231 X:107669609-107669631 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195973955 X:110505124-110505146 AAGGAAAAGGAAAAGGGGGAAGG - Intergenic
1195973964 X:110505155-110505177 AAGGAGAAGGAGAAGGGAAAGGG - Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196727060 X:118905263-118905285 GAGAAGAAGAAGAAGGGGAAGGG - Intergenic
1196859597 X:120014958-120014980 CACGAGAACCAGAAGGGCGGTGG - Intergenic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1196900029 X:120373889-120373911 CAGGAGGAGGAGGCGGGGGAGGG - Intronic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197119517 X:122873772-122873794 CAGTAGTAGCAGCAGAGGGAAGG - Intergenic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198466887 X:136911349-136911371 GAGGGGAAGCCGAAGGGGAAAGG - Intergenic
1198467529 X:136917003-136917025 GAGGAGAAGGAGAAGAGGAAGGG - Intergenic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199653166 X:149968496-149968518 CAGGAGAACCAGAAGAGTAAGGG - Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200803837 Y:7411740-7411762 CAGCAGAGACAGAAGAGGGAAGG - Intergenic
1201145241 Y:11061156-11061178 CAGGAGACTCAGAAGTGTGATGG + Intergenic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201739703 Y:17310939-17310961 AAGGAGGAGGAGAAGGGGGGAGG - Intergenic
1202379261 Y:24261494-24261516 GAGGGGCAGCAGAAGGGTGAAGG - Intergenic
1202491521 Y:25408627-25408649 GAGGGGCAGCAGAAGGGTGAAGG + Intergenic