ID: 1166143491

View in Genome Browser
Species Human (GRCh38)
Location 19:40818767-40818789
Sequence GACCTGACCCCGCTCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166143491_1166143499 27 Left 1166143491 19:40818767-40818789 CCTGAGCTGAGCGGGGTCAGGTC 0: 1
1: 1
2: 0
3: 10
4: 152
Right 1166143499 19:40818817-40818839 CAGCGAAAAGCTCTGCAGGATGG 0: 2
1: 0
2: 0
3: 19
4: 141
1166143491_1166143498 23 Left 1166143491 19:40818767-40818789 CCTGAGCTGAGCGGGGTCAGGTC 0: 1
1: 1
2: 0
3: 10
4: 152
Right 1166143498 19:40818813-40818835 GCTGCAGCGAAAAGCTCTGCAGG 0: 2
1: 0
2: 2
3: 10
4: 160
1166143491_1166143494 1 Left 1166143491 19:40818767-40818789 CCTGAGCTGAGCGGGGTCAGGTC 0: 1
1: 1
2: 0
3: 10
4: 152
Right 1166143494 19:40818791-40818813 ATGTCCTCGGGCGCACCCAGCGG 0: 2
1: 0
2: 1
3: 8
4: 91
1166143491_1166143500 30 Left 1166143491 19:40818767-40818789 CCTGAGCTGAGCGGGGTCAGGTC 0: 1
1: 1
2: 0
3: 10
4: 152
Right 1166143500 19:40818820-40818842 CGAAAAGCTCTGCAGGATGGCGG 0: 2
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166143491 Original CRISPR GACCTGACCCCGCTCAGCTC AGG (reversed) Intronic
901847139 1:11990652-11990674 TCCCTGACCCAGCACAGCTCAGG - Intronic
904035241 1:27555518-27555540 GACCTGGCCCCTCCCAGGTCAGG + Intronic
904440404 1:30526069-30526091 CACGTGTCCCCGCCCAGCTCGGG + Intergenic
911088828 1:94001494-94001516 GGCCTGGCCTGGCTCAGCTCAGG + Intronic
913957579 1:143319114-143319136 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
914051890 1:144144478-144144500 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
914127307 1:144822063-144822085 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
919158611 1:193800519-193800541 GAACTGACTCCGTTGAGCTCAGG - Intergenic
923191828 1:231627129-231627151 GACCTGGCCCGGCTCGGCGCTGG - Intronic
1063667428 10:8072181-8072203 GACCTCTCCCAGCTCAGCTTCGG + Intronic
1066760089 10:38741469-38741491 GCCCTGACTCTGCTCAGCTCTGG + Intergenic
1066961526 10:42231299-42231321 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1069447828 10:68490178-68490200 GCCTTGACCTCCCTCAGCTCAGG - Intronic
1070817839 10:79336307-79336329 GACCTGCCTCTGGTCAGCTCAGG - Intergenic
1073650206 10:105350944-105350966 GAGCTGACCCAGCTTAGCTCTGG + Intergenic
1076691439 10:132225616-132225638 CACCTGACCCCTCTCTGCACAGG - Exonic
1076866254 10:133167823-133167845 GCCCTGAGCCCCCTCCGCTCAGG + Intronic
1077103024 11:830512-830534 CACCCGACCCCGCTCCGCCCGGG + Intronic
1078466958 11:11557489-11557511 GCCCTGTCCCCACACAGCTCTGG + Intronic
1080772134 11:35351454-35351476 TACTTCACCCCACTCAGCTCAGG + Intronic
1082836867 11:57657510-57657532 GACCTGTCCCTGCCCAGCGCGGG + Exonic
1083860867 11:65419268-65419290 GCCCTGAGGCCCCTCAGCTCAGG - Intergenic
1084032866 11:66491472-66491494 GACCGACCCCCGCTCACCTCAGG + Exonic
1085312133 11:75522982-75523004 GACCTGAATTTGCTCAGCTCAGG - Intronic
1086472755 11:87133093-87133115 GTCCTGCCCCCTCTCACCTCAGG - Intronic
1090997093 11:131876685-131876707 AACCTGGCCTCTCTCAGCTCTGG - Intronic
1093205540 12:16244401-16244423 TGCCTGACCCCGCTTAGCTCTGG + Intronic
1096214421 12:49791641-49791663 GAGATGACCGTGCTCAGCTCAGG - Exonic
1097720573 12:63015964-63015986 GACCTCCCCGGGCTCAGCTCAGG + Intergenic
1099295168 12:80821244-80821266 GACCTCTCCCCTCTCAGCTAGGG + Intronic
1104759055 12:131286231-131286253 GGCCTGCCCCGTCTCAGCTCTGG - Intergenic
1104821554 12:131680265-131680287 GGCCTGCCCCGTCTCAGCTCTGG + Intergenic
1106408667 13:29496130-29496152 GACCCTGCCCCACTCAGCTCTGG - Intronic
1113518429 13:110920701-110920723 CAGCTGCCCCCGCTCTGCTCTGG + Intergenic
1121452833 14:94020312-94020334 GACTTGACCACGCCCATCTCTGG + Intergenic
1121571841 14:94952103-94952125 GCCCTGGCCTTGCTCAGCTCTGG - Intergenic
1122946661 14:105014122-105014144 GCCCTGCCACCCCTCAGCTCTGG - Intronic
1202930802 14_KI270725v1_random:30976-30998 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1123421556 15:20140436-20140458 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1123443499 15:20306079-20306101 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1123530782 15:21146976-21146998 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1125726067 15:41868704-41868726 GCCCTGACCCAGGTCGGCTCGGG - Intronic
1126663193 15:51052222-51052244 GACCTGCCCCAGCTCAGCAAAGG + Intergenic
1128606622 15:69041063-69041085 CACATGAACCCTCTCAGCTCAGG - Intronic
1129079379 15:73025593-73025615 TACCTGACCCAGCACAGCCCAGG - Intergenic
1129652928 15:77504408-77504430 GCCCTGAGCCAGCTCAGCTGTGG - Intergenic
1129756923 15:78104266-78104288 AACCTGAGCCCGCTCTGCCCAGG - Exonic
1130086013 15:80779140-80779162 GACCTGAGCCCGCGGAGCCCGGG - Intergenic
1130087470 15:80789945-80789967 GACATCACCCCTCTGAGCTCAGG + Intronic
1132575489 16:661930-661952 GAGCTGACCTCGCTCTGCTACGG + Exonic
1132959018 16:2612065-2612087 GTCCGCACACCGCTCAGCTCAGG - Intergenic
1132972077 16:2694040-2694062 GTCCGCACACCGCTCAGCTCAGG - Intronic
1136117006 16:28100973-28100995 GACCAGCCCCAGCTCAGCTTGGG - Intronic
1136544644 16:30948471-30948493 GACCTGGCCCGGCTCATCCCCGG - Exonic
1136722716 16:32337807-32337829 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1136841038 16:33543806-33543828 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1139436637 16:66940381-66940403 GTCCTGGCCCCGCTCAGCCCGGG - Intronic
1141033749 16:80611024-80611046 GACCTGACCACTCTCAACCCAGG + Intronic
1141461693 16:84181729-84181751 AACCTGACCCCCCTCACCTGAGG + Exonic
1203003715 16_KI270728v1_random:179957-179979 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1203135323 16_KI270728v1_random:1716364-1716386 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1203151203 16_KI270728v1_random:1844103-1844125 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1142607119 17:1088074-1088096 GACCTGACCCGGCTCCCCCCGGG + Intronic
1142710391 17:1720154-1720176 GAGCTGACCCCGCTCAACATGGG + Intronic
1145243126 17:21251227-21251249 GCCCTGACCACGGCCAGCTCTGG + Intronic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1148397750 17:47323877-47323899 GTCCTGGGCCCGCTCCGCTCGGG + Intronic
1148864898 17:50623441-50623463 GCCCTGACCCAGAGCAGCTCAGG - Intronic
1154082227 18:11269139-11269161 GACCTGACCCAGCTGAGGTTAGG - Intergenic
1160720917 19:596620-596642 GGCCTGTCCCTGCTCAGCACTGG + Intronic
1161009675 19:1954243-1954265 GGCCTGGCCCCGCTCTGCTGTGG + Intronic
1162494068 19:11013480-11013502 GTCCTGACCCCCAGCAGCTCAGG - Intronic
1162786299 19:13037018-13037040 GACCTCACCCTGTTCAGCCCAGG - Intronic
1163234615 19:16023243-16023265 GACCTGACCCTTCTTAGCTGGGG - Intergenic
1163303815 19:16464593-16464615 GACCTGCAGCCTCTCAGCTCTGG + Intronic
1165353948 19:35292263-35292285 CACCTGACCCTGCTCACGTCTGG - Intronic
1165912528 19:39237930-39237952 CACCTGGCCCCGCCCTGCTCTGG - Intergenic
1166143491 19:40818767-40818789 GACCTGACCCCGCTCAGCTCAGG - Intronic
1166184063 19:41128011-41128033 GACCTGACCCCACTCAGCTCAGG + Exonic
1167355783 19:49003202-49003224 GGCCTGACCCCTCTGAGCCCTGG - Intronic
1202691288 1_KI270712v1_random:96902-96924 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
926207460 2:10844221-10844243 GTACTCACCCAGCTCAGCTCAGG - Intergenic
927163421 2:20292255-20292277 GGCCTGACGGCGCTAAGCTCTGG - Intronic
927787038 2:25981556-25981578 GGGATGACCCCGCGCAGCTCGGG + Exonic
928410314 2:31049401-31049423 CAGCTGAGCCAGCTCAGCTCTGG - Intronic
930136023 2:47905351-47905373 GACCCGCCTCCGCTCAGCTTGGG + Intronic
930314553 2:49781829-49781851 TATCTGACCCCACTCAGTTCTGG + Intergenic
933955102 2:87357048-87357070 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
934151779 2:89154190-89154212 GACCTGCCCACCCTGAGCTCTGG - Intergenic
934215481 2:90027716-90027738 GACCTGCCCACCCTGAGCTCTGG + Intergenic
934239291 2:90253262-90253284 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
934273893 2:91563436-91563458 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
934461734 2:94216616-94216638 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
936142026 2:109948725-109948747 GAACTGGCCCCCTTCAGCTCTGG + Intergenic
936178716 2:110246685-110246707 GAACTGGCCCCCTTCAGCTCTGG + Intergenic
936202662 2:110422747-110422769 GAACTGGCCCCCTTCAGCTCTGG - Intronic
936404314 2:112188517-112188539 TACCACACCCCACTCAGCTCTGG - Intergenic
936831639 2:116654496-116654518 GACCTGACCCAGCACAGCACTGG - Intergenic
943967409 2:194354378-194354400 GGTCTGACCCAGCACAGCTCAGG + Intergenic
1168986238 20:2051394-2051416 GACATGACCCAGATCAGCTTGGG + Intergenic
1169034279 20:2436807-2436829 GTCCTGACCCCAGGCAGCTCTGG + Intergenic
1172386543 20:34537855-34537877 GACCTGACCCCATCCAGCTGAGG + Intronic
1173732366 20:45337782-45337804 GGCCTGACCCCGCTCCCTTCCGG - Intronic
1174932461 20:54830774-54830796 GACCTGAGCAGGCTCACCTCTGG + Intergenic
1175075570 20:56369791-56369813 GCCCTGACCCCGATCAGTTAAGG - Exonic
1175269099 20:57721256-57721278 GTCCTTGCCCTGCTCAGCTCCGG - Intergenic
1175374289 20:58514217-58514239 GCCCCGACCCCGCACAGGTCAGG + Intronic
1175794829 20:61765125-61765147 GCCCTGTCCCTGCTCAGCACTGG + Intronic
1176592822 21:8659599-8659621 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1179570506 21:42275946-42275968 GGCCTGACCCTGTCCAGCTCTGG + Intronic
1179811185 21:43870952-43870974 CACCTGGCCCTGCTCAGCTGGGG - Intronic
1180275675 22:10636741-10636763 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1180550158 22:16531681-16531703 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1181354518 22:22290140-22290162 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1182431720 22:30302704-30302726 GACCTGCCCCTGCCCAGCTGAGG - Intronic
1184347336 22:43921925-43921947 GACCTGACCCTGCCTTGCTCTGG + Intergenic
1184424998 22:44404078-44404100 GACCAGACCCAGCTCTCCTCAGG - Intergenic
1184960557 22:47925411-47925433 GACCTGACCCAGGTCATCTGGGG + Intergenic
1185015070 22:48338403-48338425 GACCAGAGCCCGGTGAGCTCTGG - Intergenic
1185398554 22:50604576-50604598 GACCCGGCCCCGCGCAGCCCGGG + Exonic
950193300 3:10992648-10992670 GCCCGGAGCCCGCCCAGCTCGGG - Intergenic
954132374 3:48567222-48567244 GCCCTGACCTCCCTCAGCTCTGG + Intronic
954235433 3:49253503-49253525 GACCTGCCTCCCCTCAGCTGTGG + Intronic
955753150 3:62203200-62203222 GACATGGCCCCCATCAGCTCGGG + Exonic
966424989 3:179771411-179771433 AACCTGTCCCTTCTCAGCTCAGG - Intronic
968521583 4:1036827-1036849 CAGCTGTCCCCGCTCAGCCCTGG - Intergenic
968728659 4:2259769-2259791 GACCTGTCCCCGCTGAGGCCAGG + Intronic
986821020 5:11466996-11467018 GACCTGAGCCAGGACAGCTCAGG + Intronic
991711119 5:69409415-69409437 AAGCTGAGCCCTCTCAGCTCAGG + Intronic
997228575 5:132227536-132227558 GACCTCACCACCCTGAGCTCGGG + Intronic
997881971 5:137599748-137599770 GACCTGAGCACACACAGCTCTGG + Intergenic
997977720 5:138449980-138450002 GACCTGACCCAGCTCAGAGAGGG - Intergenic
1000251072 5:159496273-159496295 CACCTGATCTCGCACAGCTCAGG - Intergenic
1006927316 6:37664230-37664252 GGCCTGACCCCACTGAGCCCAGG + Intronic
1007655301 6:43447921-43447943 GAGCTGGCCCAGCTCAGGTCTGG + Exonic
1010569933 6:77463963-77463985 GACTTCACCCCACCCAGCTCTGG - Intergenic
1012871913 6:104682942-104682964 GCCCTGGCCCCCCTCAGCTCTGG - Intergenic
1012947807 6:105486733-105486755 GCCCCGACCCTGCTCCGCTCTGG + Intergenic
1017950411 6:159130891-159130913 GAGCAGACCCCGCTCATCTCAGG + Intergenic
1018522530 6:164666591-164666613 GTCCTGGCCCTGCTCACCTCAGG + Intergenic
1018874272 6:167806284-167806306 GACCTGAGCCCCCTGAGCTCAGG + Intergenic
1019730468 7:2626970-2626992 GGCCTGGCCATGCTCAGCTCAGG + Intergenic
1020046047 7:5041254-5041276 GACCAGACCCCGGTCAGGTGTGG - Intronic
1023677297 7:42643610-42643632 GCCCTGGCCTCGCTCAGCCCAGG - Intergenic
1026681879 7:72473062-72473084 GAGCTGACCCAGCTAAGCACAGG - Intergenic
1034988600 7:155533507-155533529 GAGCTGGCCCCGCTCTGCGCGGG - Intronic
1041798915 8:61776813-61776835 GACCTTACCCTGCTCTGTTCAGG + Intergenic
1042433590 8:68737892-68737914 GACCTGAACTCACTCAGCACTGG + Intronic
1048979938 8:139697858-139697880 GACCTGGGCTCGCTCTGCTCTGG - Intronic
1049576275 8:143391347-143391369 GACGTGCCCCATCTCAGCTCAGG - Intergenic
1053692208 9:40592268-40592290 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1054272592 9:63045217-63045239 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1054303466 9:63393234-63393256 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1054402245 9:64719744-64719766 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1054435848 9:65204059-65204081 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1054494544 9:65817628-65817650 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1061884365 9:133584155-133584177 GACCTGGTCCCTCTCAGCTCTGG - Intronic
1062012154 9:134273050-134273072 GCCCTGAGCCTGCTCAGCCCCGG + Intergenic
1203622868 Un_KI270749v1:138405-138427 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1190911330 X:54774888-54774910 GACCAGTCTCAGCTCAGCTCAGG + Intronic
1190919893 X:54841327-54841349 GACCAGTCTCAGCTCAGCTCAGG - Intergenic
1195210778 X:102651306-102651328 GTCCTGGCCCCGCCCACCTCTGG + Intergenic
1196684202 X:118496389-118496411 GAGCTGACCTCGCGCTGCTCTGG + Intronic
1200228904 X:154434373-154434395 GACCTGACTCCCCTCACCTTTGG + Exonic