ID: 1166144367

View in Genome Browser
Species Human (GRCh38)
Location 19:40824061-40824083
Sequence TTATACCCAGAGGTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166144367 Original CRISPR TTATACCCAGAGGTGGAGCT TGG Intronic
900289807 1:1919078-1919100 TTGTCCCCACAGGTGGCGCTGGG - Exonic
900816769 1:4853293-4853315 TTATCCCCAGTGTTGGAGGTGGG + Intergenic
900996557 1:6126294-6126316 CCATACCCAGAGGTGGAGGGTGG - Intronic
901276686 1:7996965-7996987 TTATCCCCAGTGTTGGAGGTGGG - Intergenic
903034067 1:20483789-20483811 TTATGCCCAGAGTGGGAGGTCGG + Intronic
904022303 1:27476486-27476508 TAATACCCAGTGTTGGAGATGGG - Intronic
904953475 1:34263195-34263217 TCATATTCAGAGGTGGAGGTCGG + Intergenic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
906461121 1:46035605-46035627 AGCTTCCCAGAGGTGGAGCTGGG - Exonic
907829767 1:58053562-58053584 TGATACCCAGTGTTGGAGTTGGG - Intronic
907855164 1:58296011-58296033 TGAACCCCAGAGGTGGAGGTTGG + Intronic
908052271 1:60246356-60246378 TTATACCAAAAGGTGGAAGTAGG + Intergenic
908404149 1:63797437-63797459 TGATTCCCAGAGGAGGAACTCGG - Intronic
911768098 1:101703175-101703197 TGCTGCCCAGAGGTAGAGCTAGG + Intergenic
913330591 1:117663887-117663909 TTATTCCCAGTGTTGGAGGTGGG + Intergenic
917902801 1:179559890-179559912 TTTTACCCTCAGGTGGAGGTGGG - Intronic
917956232 1:180101750-180101772 TTAAACCCAAAGGTGGATCTTGG - Intronic
918808316 1:189079581-189079603 TGATCCCGAGAGGCGGAGCTTGG + Intergenic
921052145 1:211518299-211518321 GTATGCCCAGAGGCTGAGCTTGG - Intergenic
921601450 1:217110753-217110775 TAATACCCAGTGCTGGAGGTGGG - Intronic
922459998 1:225808658-225808680 TTAACGCCAGAGGTGGGGCTTGG - Intergenic
923862020 1:237900776-237900798 TTTGACCCAGAGTTGGGGCTAGG - Intergenic
1064341232 10:14487378-14487400 TCACCTCCAGAGGTGGAGCTCGG - Intergenic
1064679833 10:17798936-17798958 TTATTCCCAGAGGGTGAGCAGGG - Exonic
1066046355 10:31598917-31598939 TTATCCCCAGTGCTGGAGGTGGG + Intergenic
1068006308 10:51395466-51395488 TCAAACCCAGAGGTAAAGCTGGG + Intronic
1071147072 10:82588212-82588234 TAATCCCCAGAGTTGGAGGTAGG + Intronic
1072914573 10:99530155-99530177 TTATGCCCAGAGCAGGAGTTTGG - Intergenic
1074927329 10:118086469-118086491 TAATCCCCAGTGTTGGAGCTGGG - Intergenic
1075077961 10:119363919-119363941 TCTGTCCCAGAGGTGGAGCTGGG + Intronic
1076191350 10:128485651-128485673 TAATCCCCAGTGGTGGAGGTGGG - Intergenic
1077663959 11:4092082-4092104 TGAACCCCAGAGGTGGAGCTGGG - Exonic
1079554198 11:21739406-21739428 TAATCCCCAGTGTTGGAGCTGGG - Intergenic
1079771064 11:24460534-24460556 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1080882174 11:36332598-36332620 TGATCCCCAGTGGTGGAGGTGGG + Intronic
1081036887 11:38159475-38159497 TTATCCCCAGTGTTGGAGGTGGG + Intergenic
1081590233 11:44417642-44417664 TTATCCCCAGTGTTGGAGGTGGG - Intergenic
1082103344 11:48192675-48192697 TGATTCCCAGTGTTGGAGCTGGG - Intergenic
1083447199 11:62715982-62716004 TTCCACCCAGATGTGGAGCCAGG - Intronic
1083847412 11:65344110-65344132 TCATATCCAGAGCAGGAGCTGGG - Intronic
1084233578 11:67771039-67771061 TAATCCCCAGTGTTGGAGCTGGG + Intergenic
1085729641 11:78985859-78985881 GTAGACCCAGAGGGGGAGCCTGG - Intronic
1085835235 11:79948934-79948956 TTATAGCCAGAGGCATAGCTAGG + Intergenic
1087545174 11:99575813-99575835 GTCTCCCCAGGGGTGGAGCTGGG + Intronic
1088149142 11:106723194-106723216 TTATACGCAGACATGGAGCAGGG - Intronic
1088954018 11:114599836-114599858 TAATCCCCAGTGTTGGAGCTGGG - Intergenic
1089194641 11:116687054-116687076 TAAGACCTAGAGGTGGAGGTGGG - Intergenic
1090585356 11:128206145-128206167 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1092552684 12:9521115-9521137 TTATCCCCAGTGCTGGAGGTGGG - Intergenic
1092601569 12:10072019-10072041 TTATCCCCAGTGTTGGAGATGGG + Intronic
1092970869 12:13693557-13693579 TTACATCCAGAGGCTGAGCTGGG + Intronic
1093079742 12:14795786-14795808 ATATATCCAGTGGTGGAGGTTGG + Intronic
1094408070 12:30139998-30140020 TGATCCCCAGTGTTGGAGCTGGG + Intergenic
1094519429 12:31169506-31169528 TTATCCCCAGTGTTGGAGGTGGG + Intergenic
1094748022 12:33369044-33369066 TTATACTCATAGTTGGAACTTGG + Intergenic
1097075130 12:56387367-56387389 TGATCCCCAGTGTTGGAGCTGGG - Intergenic
1097812518 12:64034123-64034145 TAATACCCAGTGTTGGAGGTGGG + Intronic
1097998722 12:65918340-65918362 TTATAAAGAGAAGTGGAGCTTGG + Intronic
1100340006 12:93669847-93669869 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1100432538 12:94543472-94543494 TAATCCCCAGAGTTGGAGGTGGG + Intergenic
1100534726 12:95497582-95497604 ATATACCCAGAAGTGGATTTGGG + Intronic
1100763986 12:97843287-97843309 TTATACCCAAGGGTGAAGCAAGG + Intergenic
1101148087 12:101860544-101860566 GTATACCCAGGCTTGGAGCTGGG - Intergenic
1101606624 12:106251715-106251737 TTACACCCAGAGGAGGAGGCTGG + Intronic
1101791740 12:107933935-107933957 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1102001804 12:109562020-109562042 TGATCCCCAGAGTTGGAGGTGGG + Intronic
1102058406 12:109914035-109914057 AGATGACCAGAGGTGGAGCTGGG - Intronic
1104099162 12:125589930-125589952 TAATCCCCAGTGGTGGAGGTGGG + Intronic
1104431421 12:128719489-128719511 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1105320311 13:19313894-19313916 TTACTCCCAGAAGTGGAGTTGGG + Intergenic
1106820123 13:33455424-33455446 TTACACCCAGAAGTGAAGCCAGG + Intergenic
1108165281 13:47686710-47686732 TAAGACCAAGAGGTGGAGCATGG - Intergenic
1108279733 13:48849579-48849601 TTATCCCCAGTGTTGGAGGTGGG + Intergenic
1109220887 13:59639876-59639898 TAATACCCAGTGTTGGAGGTGGG + Intergenic
1109910409 13:68904210-68904232 TAATCCCCAGTGTTGGAGCTGGG + Intergenic
1110711126 13:78652334-78652356 TTCTACCCAGAGCAGGATCTGGG - Intronic
1111494685 13:89033108-89033130 TAATTCCCAGTGTTGGAGCTGGG + Intergenic
1114374994 14:22135374-22135396 ATATACCCAGAGGTAGGGTTTGG - Intergenic
1114495209 14:23127283-23127305 GTGTACCCCGAGGTGGAGCGGGG - Exonic
1115480334 14:33854797-33854819 TTATATCCAAAGGTTGAGATGGG - Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117209440 14:53480692-53480714 TAATCCCCAGTGGTGGAGGTGGG - Intergenic
1117991672 14:61439842-61439864 TTATAACCAGAGGAGGATTTAGG - Intronic
1118138783 14:63056928-63056950 TCATACCCGGAGGTGGAGCATGG + Intronic
1119916344 14:78405728-78405750 ATATTCCCAGACTTGGAGCTGGG + Intronic
1121075168 14:91061547-91061569 TTATTCCCAGACGAGGAACTGGG + Intronic
1121861240 14:97320824-97320846 TAATCCCCAGTGTTGGAGCTAGG - Intergenic
1122725010 14:103744783-103744805 CTCAGCCCAGAGGTGGAGCTGGG - Intronic
1123161334 14:106280927-106280949 TTATTCCCAGTGTTGGAGGTGGG + Intergenic
1123634437 15:22289920-22289942 TTGAACCCAGAGGCGGAGGTTGG - Intergenic
1124002492 15:25770641-25770663 TTAGGCCCAGAGGTGGAGCCAGG + Intronic
1127542128 15:59951243-59951265 TTATTCCCAGTGTTGGAGGTGGG + Intergenic
1128735464 15:70051337-70051359 TTCTACCCAGAGTTGAAACTTGG - Intronic
1130460419 15:84155570-84155592 TTCCTCCCAGAGCTGGAGCTGGG + Intergenic
1130894567 15:88160152-88160174 TGAGACCCAAAGCTGGAGCTGGG + Intronic
1132613040 16:827165-827187 TTATGAGCAGAGGTGGAGCCAGG - Intergenic
1134288484 16:12883016-12883038 TGATCCCCAGAGTTGGAGATGGG - Intergenic
1135497062 16:22962091-22962113 TTATTCCCAGTGTTGGAGGTGGG - Intergenic
1135574819 16:23577331-23577353 TTAGTCCCAGATGTGGAGATTGG - Intergenic
1140052851 16:71498142-71498164 TAATCCCCAGTGGTGGAGGTGGG + Intronic
1141145680 16:81528461-81528483 ATATGACCAGAGGTGGAGCGTGG + Intronic
1141210351 16:81973757-81973779 AGATACCCAGAGGTGGGCCTAGG - Intergenic
1141544497 16:84755716-84755738 TGAGACCCAGAGGCGGAGGTTGG + Intronic
1141945511 16:87306288-87306310 ATATACCCCGAAGTGGAGATTGG - Intronic
1142991387 17:3733499-3733521 TTGAACCCGGAGGTGGAGATTGG - Intronic
1144145674 17:12395713-12395735 TTAGAGCCAGAGCTAGAGCTTGG - Intergenic
1145227827 17:21145242-21145264 TGAACCCCGGAGGTGGAGCTTGG + Intronic
1146757562 17:35447107-35447129 TTATACCCAAAGGAAGAGCTGGG - Intronic
1148086484 17:44996618-44996640 TTCTACCCAGTGGAGGAGATGGG + Intergenic
1148689839 17:49520800-49520822 TTAGGCCCTGGGGTGGAGCTGGG - Intergenic
1148721350 17:49755561-49755583 TTATAGCTAGAGGGTGAGCTTGG - Intronic
1148887349 17:50783416-50783438 TTACACCCAAAGGTGGTGCTGGG - Intergenic
1151566428 17:74901071-74901093 TTATTCACAGGGGTGGGGCTGGG + Intergenic
1151877452 17:76874839-76874861 TTAGACCCAGACCTGCAGCTGGG - Intronic
1153677671 18:7469795-7469817 TTAAGCCAAGAGGTCGAGCTGGG + Intergenic
1156125563 18:33900359-33900381 TCATCCCCAGTGTTGGAGCTGGG - Intronic
1156960361 18:43021500-43021522 TTATCCCCAGTGTTGGAGGTGGG + Intronic
1157768075 18:50317880-50317902 TTATCCCCAGTGTTGGAGATGGG + Intergenic
1159902474 18:74060543-74060565 TTGACTCCAGAGGTGGAGCTTGG + Intergenic
1161868862 19:6854958-6854980 ATATACAAAGAGGTAGAGCTGGG + Intronic
1162016905 19:7851062-7851084 TGAGACCCAGAGGTGGAGCATGG - Intronic
1162079734 19:8210721-8210743 ATAAACACAGAAGTGGAGCTGGG + Exonic
1163624362 19:18380421-18380443 GGGTCCCCAGAGGTGGAGCTGGG - Intronic
1164445642 19:28315603-28315625 TTAAAACCAGAGGTGAAACTGGG - Intergenic
1164555713 19:29249292-29249314 TGATCCCCAGAGTTGGAGGTGGG + Intergenic
1165402927 19:35613277-35613299 TCACATCCAGAGGTGGAGGTGGG - Intronic
1166144367 19:40824061-40824083 TTATACCCAGAGGTGGAGCTTGG + Intronic
1166183382 19:41123989-41124011 ATACACCCAGAGATGGAGCTTGG - Intronic
1167148653 19:47696619-47696641 CGCTACCAAGAGGTGGAGCTGGG - Intronic
1167925900 19:52820985-52821007 ATTTTCCCAGAGCTGGAGCTGGG + Intronic
925881815 2:8359097-8359119 TTAAAGTCAGAGGTGAAGCTGGG - Intergenic
926227124 2:10974865-10974887 TAATCCCCAGAGTTGGAGGTGGG - Intergenic
927781045 2:25939653-25939675 TTAAACCCAGAGGCAGAGCCTGG + Intronic
928033705 2:27802263-27802285 TAATCCCCAGTGTTGGAGCTGGG - Intronic
928231192 2:29500170-29500192 TAATACCCAGTGTTGGAGGTGGG + Intronic
928338261 2:30417585-30417607 ATTTACCCTGTGGTGGAGCTGGG + Intergenic
928601384 2:32907213-32907235 ATATACCTAGGAGTGGAGCTGGG - Intergenic
928613694 2:33015996-33016018 TAATCCCCAGAGTTGGAGGTGGG - Intronic
929022582 2:37568220-37568242 TGATACCAAGTGGTGGAGCTCGG + Intergenic
929806561 2:45151406-45151428 TAATCCCCAGTGTTGGAGCTGGG + Intergenic
930305463 2:49669468-49669490 TAATCCCCAGAGTTGGAGGTGGG - Intergenic
930490216 2:52059361-52059383 TAATTCCCAGTGGTGGAGGTGGG + Intergenic
930906483 2:56574596-56574618 TAATCCCCAGTGGTGGAGGTGGG + Intergenic
931526709 2:63164320-63164342 TAATCCCCAGAGTTGGAGGTCGG + Intronic
932743666 2:74313178-74313200 TTAAAACCAGAGGAGGAGCTGGG - Intronic
934018408 2:87916507-87916529 TAATACCCAGTGTTGGAGGTGGG + Intergenic
934650158 2:96085961-96085983 GGATCCCCAGAGGTGGAGCTGGG - Intergenic
935260182 2:101348364-101348386 TTAAACCTAGAGATGGAGATGGG + Exonic
935750039 2:106223731-106223753 TAATACCCAGTGTTGGAGGTGGG - Intergenic
936121171 2:109746693-109746715 TAATACCCAGTGTTGGAGGTGGG + Intergenic
936223524 2:110624778-110624800 TAATACCCAGTGTTGGAGGTGGG - Intergenic
936661244 2:114546451-114546473 TTATCCCCAGTGTTGGAGGTGGG - Intronic
937298575 2:120824563-120824585 TTACAGCCAGAGATGGAGCAGGG - Intronic
937868743 2:126772691-126772713 TAATACCCAATGGTGGAGGTGGG - Intergenic
939771050 2:146318837-146318859 ATATAACCAGAGGTGGCTCTTGG - Intergenic
940467384 2:154048284-154048306 TAATACCCAGTGTTGGAGGTGGG - Intronic
940690602 2:156914777-156914799 TGAGCCCCAGAGGTGGAGGTTGG - Intergenic
941549894 2:166901956-166901978 TTTTAGCCAGAGATAGAGCTGGG + Intronic
942824246 2:180155046-180155068 TTATACCCAAAGGAAGAGGTAGG + Intergenic
942914138 2:181282190-181282212 TAATACCCAGTGCTGGAGGTGGG - Intergenic
944447699 2:199807913-199807935 TAATACCCAGTGTTGGAGGTGGG + Intronic
945125689 2:206507252-206507274 TAATCCCCAGTGGTGGAGGTGGG + Intronic
945446058 2:209939980-209940002 TGAAACCCGGAGGTGGAGCGTGG - Intronic
945806162 2:214492258-214492280 CTATCCCCAGAGGTAGAGGTTGG + Intronic
948865821 2:240774281-240774303 TTGTGCCCAGAGGGGGATCTAGG + Intronic
1170590038 20:17764934-17764956 TGATCCCCAGTGTTGGAGCTGGG - Intergenic
1171047710 20:21826471-21826493 TCATACACAGAGGAAGAGCTTGG + Intergenic
1171104332 20:22418060-22418082 TAATCCCCAGTGTTGGAGCTGGG - Intergenic
1173134890 20:40431016-40431038 TTTTAACCAGAGGTGTAACTTGG + Intergenic
1173768862 20:45640334-45640356 TTATCCCCAGTGTTGGAGGTGGG - Intergenic
1173847227 20:46195903-46195925 TTATACACAGCGGCGGCGCTTGG - Intronic
1175932991 20:62502252-62502274 TCAGACCCTGAGGTGGGGCTGGG + Intergenic
1176690509 21:9903211-9903233 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1177445972 21:21196797-21196819 TTATCCCCAGTGTTGGAGGTGGG + Intronic
1178268682 21:31168811-31168833 TAATACCCAGAGATAGAGCTTGG + Intronic
1180998857 22:19978609-19978631 TGACAGCCAGAGGGGGAGCTGGG - Intronic
1181550490 22:23636523-23636545 TTATACCCAGAGAAGGAGAGAGG + Intergenic
1181797788 22:25322169-25322191 TTATACCCAGAGAAGGAGAGAGG - Intergenic
1182506653 22:30788000-30788022 TTAAGCCCAGACATGGAGCTTGG - Intronic
1182998076 22:34832730-34832752 ATGAACCCAGAGGCGGAGCTTGG - Intergenic
1183301982 22:37063043-37063065 TTATGCCCAGGGGTCGGGCTGGG - Exonic
1184452443 22:44591130-44591152 TTAGACCCAGCTGAGGAGCTGGG + Intergenic
1185104533 22:48859809-48859831 TTAGACCCAGTGGAGGAGCCTGG + Intergenic
950256780 3:11512323-11512345 CTTGACCCAGAGGTGGAACTCGG - Intronic
950802063 3:15560517-15560539 TGATCCCCAGTGGTGGAGGTAGG - Intergenic
951655885 3:25007891-25007913 TTATACCCACAGGGTGACCTTGG + Intergenic
953660613 3:44888916-44888938 GTAGCCCAAGAGGTGGAGCTGGG - Intronic
954331000 3:49890239-49890261 TCCTACCCAGAGTTGGGGCTGGG + Intronic
954698417 3:52439628-52439650 TCAGACCCAGAGATGGGGCTTGG + Intronic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
955485183 3:59427976-59427998 CTAGAGCCAGAGGTGGAGGTGGG + Intergenic
956330572 3:68102550-68102572 TTTTACCCAGGGGTGAGGCTCGG + Intronic
956901852 3:73724896-73724918 TAATACCCAGTGTTGGAGATGGG - Intergenic
957758876 3:84529588-84529610 TTACACCCAGAGCTGAAGTTTGG + Intergenic
958736518 3:98015828-98015850 TGATACCCAGTGTTGGAGGTGGG + Intronic
960548384 3:118944872-118944894 TGAGACCCAGAGATGGAACTGGG + Intronic
961259960 3:125594594-125594616 TTATTTCCCGAGGTGGAGGTAGG - Intronic
961883160 3:130077395-130077417 TAATCCCCAGTGTTGGAGCTGGG + Intergenic
963189144 3:142450073-142450095 TAATTCTCAGAGGTGGTGCTGGG + Intronic
965823588 3:172709101-172709123 GTATACCCTCAGGTGGTGCTTGG - Intronic
966008160 3:175042804-175042826 TGATACCCAGTGTTGGAGATGGG + Intronic
969821570 4:9724733-9724755 TAATCCCCAGTGTTGGAGCTGGG - Intergenic
969825889 4:9758440-9758462 TAATATCCAGGGGTGGAGCGGGG - Intergenic
970071556 4:12165156-12165178 TGATACCCAGTGTTGGAGGTGGG - Intergenic
970132131 4:12883994-12884016 TAATCCCCAGAGTTGGAGGTTGG + Intergenic
970142221 4:12995169-12995191 TGATACCCAGTGTTGGAGGTGGG - Intergenic
970161494 4:13193802-13193824 TTACACCCAGAGGTGGAGCCAGG + Intergenic
970570888 4:17381459-17381481 TTCCAGCAAGAGGTGGAGCTGGG - Intergenic
972679285 4:41289854-41289876 TTGAATCCAGAGGTGGAGGTTGG + Intergenic
974382626 4:61160855-61160877 TTATTCTCAGTGTTGGAGCTGGG - Intergenic
975317926 4:72976902-72976924 TGGAACCCAGAGGTGGAGGTTGG + Intergenic
976869521 4:89774190-89774212 GAATACCCAGAGGTGGAGCTGGG - Intronic
979037280 4:115737931-115737953 ATATACCCAGAGCTTTAGCTGGG - Intergenic
979282325 4:118881546-118881568 TTATGCCCCGAGGGGGAGCAAGG + Intronic
981659293 4:147147071-147147093 TTATCCCCAGAGTTGGAGGTGGG + Intergenic
982893525 4:160886452-160886474 TTATACTGAGAGGTGAAGCCAGG - Intergenic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983736411 4:171068081-171068103 TTATCCCCAGTGTTGGAGGTGGG + Intergenic
985306580 4:188548692-188548714 TTATCCCCAGAGGAAGAACTAGG + Intergenic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
988156552 5:27459054-27459076 TTATTCCCAGTGTTGGAGGTGGG - Intergenic
989640026 5:43575322-43575344 TTATCCCCAGTGTTGGAGGTTGG + Intergenic
990005571 5:50940233-50940255 TAATACCCAGTGGTGGAGTGAGG - Intergenic
990434303 5:55772568-55772590 TGATTCCCAGAGTTGGAGGTAGG + Intronic
991491971 5:67192715-67192737 TAATCCCCAGTGGTGGAGGTAGG - Intronic
994221572 5:97201592-97201614 TAATCCCCAGTGTTGGAGCTGGG - Intergenic
994902736 5:105797402-105797424 TTATCCCCAGTGGTGGAGGAGGG + Intergenic
997737923 5:136228162-136228184 TTGTACCCAGAGCTGGAGGAGGG + Intronic
999245130 5:150150154-150150176 TGAACCACAGAGGTGGAGCTGGG + Intronic
1003667032 6:8121015-8121037 TTATCCCCAGTGCTGGAGGTGGG - Intergenic
1004013279 6:11709625-11709647 TGATACCCAGTGTTGGAGGTGGG - Intergenic
1004096106 6:12556149-12556171 TAATACCCAGTGTTGGAGGTGGG + Intergenic
1004165753 6:13255325-13255347 TAATACCCAGTGTTGGAGGTGGG - Intronic
1004627423 6:17390057-17390079 TTATCCCCAGTGCTGGAGGTGGG + Intergenic
1005149280 6:22730247-22730269 TAATCCCCAGTGTTGGAGCTGGG + Intergenic
1006002609 6:30977313-30977335 GTCTACCCAGAGATAGAGCTGGG + Intergenic
1006803835 6:36776219-36776241 TTCTAACCAGAGATGTAGCTGGG - Intronic
1007898824 6:45391177-45391199 TGATTCCCAAAGTTGGAGCTGGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1009214529 6:60904879-60904901 TTACACATAGAGGTGGAGCATGG - Intergenic
1010024941 6:71204289-71204311 TTATCCCCAGTGTTGGAGGTGGG - Intergenic
1010341522 6:74759123-74759145 TAATACCCAGTGTTGGAGGTGGG + Intergenic
1011410916 6:87065360-87065382 TTATACCCAGGCTTTGAGCTAGG - Intergenic
1011606926 6:89115360-89115382 TGAACCCCAGAGGTGGAGGTTGG - Intronic
1012907212 6:105081712-105081734 CTTTGCCCAGAGGTGGAGGTTGG + Exonic
1013146001 6:107392823-107392845 TTATACCCAGACTTCAAGCTTGG + Intronic
1014665531 6:124232195-124232217 TTTTACCCAGAGAATGAGCTGGG - Intronic
1014740861 6:125146510-125146532 TAATACCCAGTGTTGGAGGTAGG + Intronic
1015252394 6:131141167-131141189 TTATCCCCAGTGTTGGAGGTGGG + Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016230292 6:141795563-141795585 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1016471143 6:144375819-144375841 TGAAACAAAGAGGTGGAGCTAGG - Intronic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016828750 6:148412751-148412773 TGATCCCCAGTGGTGGAGGTGGG - Intronic
1017920315 6:158866646-158866668 TTATGGTCAGAGTTGGAGCTTGG + Intergenic
1019005171 6:168790568-168790590 TAATACCCAGTGCTGGAGGTGGG + Intergenic
1019620593 7:1990016-1990038 TAATAACAAGAGGAGGAGCTGGG + Intronic
1020317180 7:6914127-6914149 TAATCCCCAGTGTTGGAGCTGGG + Intergenic
1020819078 7:12943253-12943275 TAATACCCACATGTGGAACTGGG + Intergenic
1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG + Intergenic
1022876493 7:34537712-34537734 ATATACCCAGAAGGGCAGCTAGG - Intergenic
1023030978 7:36090187-36090209 TTATCCCCAGTGTTGGAGGTGGG + Intergenic
1026141517 7:67710873-67710895 TCATTCTAAGAGGTGGAGCTGGG - Intergenic
1027345788 7:77258154-77258176 TTGCACCCAGAGGTGGGGGTGGG + Intronic
1029813541 7:103072478-103072500 TTTCACCCAGAGGGGGAACTGGG + Intronic
1031857249 7:126937588-126937610 TTATACCCAGAGAGTGAGTTTGG + Intronic
1033170352 7:139078412-139078434 ATATACCCAGAAGTGGAGTTGGG - Intronic
1033434708 7:141322453-141322475 TGATCCCGGGAGGTGGAGCTTGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035006301 7:155663590-155663612 TAATACCCAGTGTTGGAGGTGGG - Intronic
1035261267 7:157663119-157663141 TTATGGCCGGGGGTGGAGCTCGG - Intronic
1036418481 8:8573096-8573118 TAATACCCAGTGTTGGAGGTGGG + Intergenic
1038743958 8:30239699-30239721 TGATTTCCAGAGGTGAAGCTGGG - Intergenic
1039118324 8:34117126-34117148 TAATCCCCAGTGCTGGAGCTGGG + Intergenic
1039349929 8:36752889-36752911 TTATACTCAGAGGTGGTGTATGG - Intergenic
1039402967 8:37287283-37287305 TAATCCCCAGTGGTGGAGGTGGG + Intergenic
1039743437 8:40402638-40402660 TTATTCCCAGTGTTGGAGGTGGG - Intergenic
1040592070 8:48802727-48802749 TTTTACCAAGAGCTGAAGCTGGG + Intergenic
1043066629 8:75579474-75579496 TGATTCCCAGAGTTGGAGGTGGG + Intergenic
1043689792 8:83136249-83136271 TTCTACTCAGAGGTGGCACTTGG - Intergenic
1043758122 8:84029944-84029966 TTATTCCCAAAGGTGAAGGTAGG - Intergenic
1047022291 8:120787138-120787160 AAATACCCAGAGCTGAAGCTAGG + Intronic
1048960445 8:139572571-139572593 TTATAAGAAGAGGTGGATCTGGG - Intergenic
1049436510 8:142588569-142588591 TGATTCCCAGGGTTGGAGCTGGG + Intergenic
1049517240 8:143066973-143066995 TAATCCCCAGTGGTGGAGGTGGG + Intergenic
1051040365 9:12802293-12802315 TCATCCCCAGTGGTGGAGGTTGG + Intronic
1051506968 9:17838085-17838107 TTATACTCTGGGATGGAGCTTGG - Intergenic
1052286011 9:26786593-26786615 TGATACCCAGTGTTGGAGGTGGG + Intergenic
1052382848 9:27789988-27790010 TTATCCCCAGTGTTGGAGGTGGG + Intergenic
1053186783 9:36023043-36023065 TAATCCCCAGTGCTGGAGCTGGG - Intergenic
1053417409 9:37955409-37955431 GTATACACAGAGGGGGAGGTAGG + Intronic
1053438632 9:38095261-38095283 TGAAACCCAGTGTTGGAGCTGGG + Intergenic
1053442918 9:38130685-38130707 CCATACTCAGAGGTGGAGGTTGG + Intergenic
1053778757 9:41578297-41578319 TAATACCCAGTGTTGGAGGTGGG + Intergenic
1054166719 9:61788537-61788559 TAATACCCAGTGTTGGAGGTGGG + Intergenic
1055012413 9:71581225-71581247 TTATTCCCAGCAGTGGAGCTGGG + Intergenic
1056370308 9:85947498-85947520 TGTTACCAAGAGGTGGAGCATGG + Intronic
1056401307 9:86230068-86230090 TTATCCCCAGTGTTGGAGGTGGG - Intronic
1058182051 9:101810143-101810165 TAATCCCCAGTGGTGGAGGTAGG + Intergenic
1058381809 9:104384951-104384973 TTATACCCAGATCTGGAGAATGG + Intergenic
1058462605 9:105196999-105197021 TTATACCTAGAGGCAGACCTTGG - Intergenic
1058845252 9:108951088-108951110 TGAAACCGGGAGGTGGAGCTTGG - Intronic
1060073645 9:120572499-120572521 TGATTCCCAGAGGTGGTGATAGG - Intronic
1060880827 9:127116878-127116900 TGCTACCAAGTGGTGGAGCTGGG + Intronic
1061360851 9:130141406-130141428 TGAACCCCAGAGGTGGAGGTTGG + Intergenic
1061851123 9:133416335-133416357 TGATCCCCAGTGGTGGAGATGGG - Intronic
1186444386 X:9614258-9614280 ATATACCCAAAGTGGGAGCTTGG - Intronic
1187312419 X:18158061-18158083 TAATACCCACTGCTGGAGCTGGG + Intergenic
1189116935 X:38352475-38352497 AAATACACAGCGGTGGAGCTTGG + Intronic
1189374448 X:40455735-40455757 TGATCCCCAGAGCTGGAGGTTGG - Intergenic
1191041610 X:56087278-56087300 TTATCCCCAGTGTTGGAGGTGGG + Intergenic
1191992013 X:67048431-67048453 TTATACCCAGGCCTGGGGCTAGG - Intergenic
1193945641 X:87729665-87729687 TGATACCCAGTGTTGGAGGTGGG - Intergenic
1194478840 X:94394694-94394716 TAATACCAAGAGCTGGAGGTGGG + Intergenic
1195160241 X:102163677-102163699 TTATCCCCAAAGTTGGAGTTGGG - Intergenic
1196721618 X:118859732-118859754 TAATTCCCAGTGTTGGAGCTGGG + Intergenic
1197501588 X:127248968-127248990 TTCTACAAAGAGCTGGAGCTAGG + Intergenic
1198688197 X:139250281-139250303 TTATCCCCAGTGTTGGAGATGGG - Intergenic
1198873524 X:141200297-141200319 TGATTCCCAGTGTTGGAGCTGGG - Intergenic
1199126125 X:144122631-144122653 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1199421670 X:147651168-147651190 TAATCCCCAGAGCTGGAGGTGGG + Intergenic
1199719077 X:150529256-150529278 TAATACCCAGTGTTGGAGGTGGG - Intergenic
1200727011 Y:6684076-6684098 TAATCCCCAGTGGTGGAGGTGGG + Intergenic
1200728163 Y:6699851-6699873 TAATCCCCAGTGGTGGAGGTGGG + Intergenic
1201313671 Y:12621609-12621631 GTGTGCCCAGCGGTGGAGCTGGG - Intergenic
1202378833 Y:24259610-24259632 TTCCTCCCAGAGCTGGAGCTGGG - Intergenic
1202491949 Y:25410511-25410533 TTCCTCCCAGAGCTGGAGCTGGG + Intergenic