ID: 1166145668

View in Genome Browser
Species Human (GRCh38)
Location 19:40833200-40833222
Sequence AGATGTAACATGGCTATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166145661_1166145668 27 Left 1166145661 19:40833150-40833172 CCTGAGGGAGGAAGTTTGGGATG No data
Right 1166145668 19:40833200-40833222 AGATGTAACATGGCTATTGGAGG 0: 2
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166145668 Original CRISPR AGATGTAACATGGCTATTGG AGG Intronic
900778969 1:4605046-4605068 GTCTGTAACATAGCTATTGGGGG + Intergenic
903537461 1:24076464-24076486 AGATGGAACCTGGTGATTGGTGG - Intronic
915004874 1:152626694-152626716 AGGTGTGATATGGCTATCGGTGG + Intergenic
917659794 1:177165807-177165829 AGATCTTACATGGGTTTTGGTGG - Intergenic
918334243 1:183492071-183492093 AGATTTAACATGAATTTTGGAGG + Intronic
919489199 1:198184403-198184425 AAATTTTACATGGCTATTGTTGG + Intronic
919523761 1:198621748-198621770 AGATGTAAAACAGCTAATGGAGG - Intergenic
924138377 1:240995985-240996007 AAATGTAACATGTCAATTTGTGG - Intronic
924490000 1:244527007-244527029 AGATGTCACAAGGCAAATGGAGG + Intronic
1066515116 10:36150031-36150053 AGCTGTAACACGGGTTTTGGAGG + Intergenic
1072410042 10:95193505-95193527 AGGTGTAACTTGGTTACTGGTGG - Intergenic
1076210503 10:128639860-128639882 AGAAGTATCATGGCTATTTTGGG - Intergenic
1079371061 11:19853055-19853077 AGTTTGAACACGGCTATTGGAGG - Intronic
1092930375 12:13309866-13309888 ATATTCAACATGTCTATTGGAGG - Intergenic
1096865250 12:54558726-54558748 AGATGGCACCTGGATATTGGTGG - Intronic
1101881944 12:108631667-108631689 AGGTGTAACTTGGTTCTTGGTGG - Intronic
1102608727 12:114091991-114092013 AGATGTATCATGGCTAAAGGAGG - Intergenic
1103739803 12:123083583-123083605 AGATGTAACATGTCTATGGGAGG + Intronic
1105441310 13:20417244-20417266 AGATGTCACAAGGCTTTGGGTGG - Intronic
1107334483 13:39339600-39339622 AAATTTAAAATGGATATTGGAGG - Intergenic
1107812107 13:44210373-44210395 AGATGATACTTGGCCATTGGTGG - Intergenic
1116027879 14:39536805-39536827 AGGTGTAACACTGCTACTGGTGG - Intergenic
1119920474 14:78441642-78441664 AGATGTAACATATCTTTTGGGGG - Intronic
1121351800 14:93179284-93179306 AGTTGAAACATGGCTATTTAAGG + Intergenic
1121879909 14:97490705-97490727 AGGTGGCACATGGCTATCGGAGG + Intergenic
1125742733 15:41978344-41978366 AGATGCAACATGACTATGGCGGG - Intergenic
1126370822 15:47945252-47945274 AGATGTAACAAAGCTATTTTAGG + Intergenic
1126847739 15:52776859-52776881 TGATGTAACATGGCCATCAGTGG + Intronic
1127990019 15:64107213-64107235 TAAGGTAACATGGCTCTTGGAGG - Intronic
1128146734 15:65336125-65336147 AGATGTTTCCTAGCTATTGGAGG - Intronic
1128801975 15:70502670-70502692 AGATGCAGCATGGCTACTGCAGG - Intergenic
1128856119 15:71017756-71017778 AAGTGTAACATGACTTTTGGTGG + Intronic
1130703950 15:86214092-86214114 AGATGTAACATGGCCATATGCGG - Intronic
1135489464 16:22896404-22896426 AGATATAAGATGGCTATGTGGGG - Intronic
1141549335 16:84794856-84794878 ACGTGTAACATGGCTAGGGGCGG - Intergenic
1144576590 17:16433593-16433615 AGATGGAGAATGGCTATTGGTGG + Exonic
1150607650 17:66707933-66707955 TGATGTAACATGGCTTTTATAGG + Intronic
1154944028 18:21143159-21143181 AGATGTACCATGTATATTCGTGG - Intergenic
1155858804 18:30869594-30869616 ATTTGTACCATGGCTTTTGGGGG + Intergenic
1158704841 18:59783079-59783101 AGATGTGACGTGGCCATTGATGG - Intergenic
1159520694 18:69517949-69517971 AGATGTAATTTGGCTAGGGGAGG - Intronic
1159525292 18:69581221-69581243 GGATGTCAAATGGGTATTGGTGG - Intronic
1163408943 19:17141422-17141444 AGAGGTAACATGGCAAGGGGAGG - Intronic
1166145668 19:40833200-40833222 AGATGTAACATGGCTATTGGAGG + Intronic
1166149777 19:40864102-40864124 AGATGTAACATGGCTATTGGAGG + Intronic
1166165937 19:40988699-40988721 AGATATAACAAGGCAAATGGAGG - Intergenic
1166838842 19:45683892-45683914 ACATGTAACATGGCCACTTGGGG - Intergenic
925271460 2:2612243-2612265 AGAGGTAACAAGGATATGGGAGG + Intergenic
926840323 2:17072521-17072543 AGATGTAAAATGGCAAGTGACGG - Intergenic
927015319 2:18953290-18953312 AGGTGTAACAACGCTAGTGGTGG - Intergenic
929162137 2:38842986-38843008 AAAGGTAACATGCCTCTTGGGGG - Exonic
929337650 2:40769751-40769773 AGATGAAAGATGGCTAGTGTTGG - Intergenic
936992349 2:118379594-118379616 TCAAGTAACAAGGCTATTGGTGG - Intergenic
939723054 2:145679061-145679083 AGATGTAACATGGCGATGCAAGG - Intergenic
939743409 2:145938245-145938267 CGCTGTAACATGGAAATTGGAGG - Intergenic
948002085 2:234576464-234576486 AGATGTAAGATTACTGTTGGGGG - Intergenic
1170067996 20:12335264-12335286 AAATGTAATATTGCTATTTGGGG + Intergenic
1178708677 21:34895391-34895413 AGAAGTGTCATGGCTGTTGGTGG + Intronic
1181361554 22:22341698-22341720 ATACGTAACATGACTGTTGGAGG + Intergenic
1182423836 22:30261633-30261655 AAATGTATCATGTCTATTGCAGG + Intergenic
1183197599 22:36364247-36364269 AGAGGTGAGATGGCTACTGGGGG - Intronic
1183820651 22:40343520-40343542 ACTTGTATCATGGCTATTGTGGG + Intergenic
1183870838 22:40740931-40740953 AGCTGTAACCTGGCTACTAGAGG + Intergenic
1184571126 22:45325695-45325717 AGATGGACCAGGACTATTGGAGG + Intronic
951906785 3:27714578-27714600 AGATGTAAGGGGGCTGTTGGGGG + Intergenic
952004471 3:28826726-28826748 AGAGGTAACATGGCGTTTGTGGG + Intergenic
952399491 3:32950226-32950248 AGATAAAACTTGGCTCTTGGAGG + Intergenic
954571545 3:51645135-51645157 AGATGTAACAGGGCTTTTTCTGG - Exonic
959008775 3:101050244-101050266 AGATGGATCAGGGCAATTGGTGG - Intergenic
962802508 3:138902398-138902420 AGATGTAACATCACCAATGGTGG - Intergenic
964814311 3:160700711-160700733 AGAGGGAACAAGGCTTTTGGTGG + Intergenic
964937765 3:162113459-162113481 GGATTTAACTTGGCTCTTGGAGG - Intergenic
964954023 3:162329923-162329945 AGAAGTACCATTGCTATTGTTGG + Intergenic
966205857 3:177405709-177405731 ATAGGTCACATGGTTATTGGAGG + Intergenic
967859153 3:194138637-194138659 ATATGTAAAAAGGCTTTTGGTGG + Exonic
970938272 4:21600770-21600792 AAATACAACATGGGTATTGGAGG - Intronic
971421341 4:26476627-26476649 AGATGTAACATGGGTTCAGGTGG + Intergenic
974398788 4:61373854-61373876 AGATATTGCATGACTATTGGGGG - Intronic
978371094 4:108030078-108030100 AGATGTCACATGGTGACTGGGGG - Intronic
979654298 4:123174343-123174365 AGCTATAACATGTCTATTGGTGG + Intronic
979749372 4:124258584-124258606 ATATATAACAAGGCTTTTGGGGG + Intergenic
981666787 4:147236985-147237007 AGTTGTCACATGACTATTTGAGG - Intergenic
982463041 4:155694945-155694967 AAAGGTAATATGGCTATAGGGGG - Intronic
982750904 4:159160471-159160493 TCATGTAACATGGATATTGTTGG + Intronic
984770481 4:183432912-183432934 AGATGTAATATACCCATTGGGGG - Intergenic
985845869 5:2346545-2346567 AGGTGTAACACTGCTACTGGTGG + Intergenic
986177008 5:5360949-5360971 AGATGTCACACGGCGATTTGGGG - Intergenic
986342687 5:6804399-6804421 AGCTGTCTCATGGCTGTTGGGGG - Intergenic
986882043 5:12186036-12186058 AGTTTTAACATGAATATTGGAGG - Intergenic
990733034 5:58830359-58830381 AGATCTACCATGGCTAATGGGGG + Intronic
994702561 5:103155285-103155307 AGCTGTAACAGGAATATTGGTGG - Intronic
997128115 5:131248993-131249015 AGATGTAACCTGGCTATTCATGG - Intronic
999268117 5:150280191-150280213 AGATGTAACGTGGCTCTGAGTGG - Intronic
999702957 5:154244943-154244965 AGATGTAAGATAGAGATTGGGGG + Intronic
1001669963 5:173465671-173465693 AGATGAAGCATGGATAATGGAGG - Intergenic
1004013766 6:11713444-11713466 AAATGGCAAATGGCTATTGGTGG - Intronic
1005057952 6:21747404-21747426 ATATTTAAAATGGCTTTTGGGGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1008248691 6:49210181-49210203 AGATGTAACCTGAATATTGTGGG + Intergenic
1013430356 6:110050055-110050077 AGACGTTACATGGATAATGGAGG - Intergenic
1015332189 6:131993444-131993466 AGATCTAACATGGATATAAGTGG + Intergenic
1015488701 6:133800640-133800662 AGGTGTAACACTGCTACTGGTGG + Intergenic
1017872602 6:158499878-158499900 AGAAGCAAGATGGCTATTGTTGG - Intronic
1019643861 7:2118782-2118804 AGATATGACGTGGCTTTTGGAGG - Intronic
1029671530 7:102035720-102035742 AGATGTAACATTTATATTGAAGG + Intronic
1033596485 7:142863219-142863241 AGATGTCCCATGGCTACTGAAGG + Exonic
1038232137 8:25711229-25711251 AGATGTGTCCTGGCTATTTGTGG + Intergenic
1039136145 8:34324909-34324931 ATAGGTAAAATGGCAATTGGTGG - Intergenic
1039165179 8:34670977-34670999 AGATGTACCATTTCTAGTGGTGG - Intergenic
1039228465 8:35416868-35416890 AGATGATACTTGGCTATTTGAGG + Intronic
1043830982 8:84988958-84988980 AGATGGAAAATGGCTACTTGTGG - Intergenic
1050327767 9:4514477-4514499 ACATGTCACATGGATCTTGGAGG + Intronic
1057957343 9:99421726-99421748 AGGTGAAACATGTCTTTTGGGGG - Intergenic
1061358507 9:130124632-130124654 AGCTGTAACCTGGCTATGGTGGG - Intronic
1187552648 X:20321648-20321670 AGAAGGTACATGGCTGTTGGTGG + Intergenic
1188987507 X:36780677-36780699 GGATGTAACAAGCCTATGGGTGG - Intergenic
1192832794 X:74767831-74767853 AGGTGTAACACTGCTATTGGTGG + Intronic
1193005778 X:76617165-76617187 AGATGCAATATCGCCATTGGTGG - Intergenic
1193051915 X:77111118-77111140 AGATGCAACACTGCTACTGGTGG - Intergenic
1193061846 X:77215222-77215244 AGGTGTAACATTGCTATCTGTGG + Intergenic
1194575579 X:95610496-95610518 AGGTGGAACATGGAAATTGGTGG - Intergenic
1194867375 X:99085838-99085860 AGTTGCAACATTGCTATAGGTGG - Intergenic
1197402106 X:126005493-126005515 AGGTGTAACACTGCTAATGGTGG - Intergenic
1198139580 X:133789230-133789252 TCATGTAACTTGTCTATTGGAGG - Intronic
1200906633 Y:8490029-8490051 AGATAAAACATAGCTATTGGTGG - Intergenic