ID: 1166147036

View in Genome Browser
Species Human (GRCh38)
Location 19:40845014-40845036
Sequence CCATTCGGCCTTTTGTCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166147036_1166147046 14 Left 1166147036 19:40845014-40845036 CCCTATGACAAAAGGCCGAATGG 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1166147046 19:40845051-40845073 TTTCTTAAGATAGGAAGTTTGGG 0: 2
1: 1
2: 4
3: 35
4: 424
1166147036_1166147045 13 Left 1166147036 19:40845014-40845036 CCCTATGACAAAAGGCCGAATGG 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1166147045 19:40845050-40845072 GTTTCTTAAGATAGGAAGTTTGG 0: 1
1: 1
2: 7
3: 44
4: 360
1166147036_1166147044 5 Left 1166147036 19:40845014-40845036 CCCTATGACAAAAGGCCGAATGG 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1166147044 19:40845042-40845064 GGGCTTCTGTTTCTTAAGATAGG 0: 2
1: 1
2: 1
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166147036 Original CRISPR CCATTCGGCCTTTTGTCATA GGG (reversed) Intronic
902521730 1:17021790-17021812 CCCTTCTGCCTTTTGCCATGGGG + Intronic
904623842 1:31791084-31791106 ACATTCGGCCTCCTGTCATCTGG + Exonic
906152678 1:43596668-43596690 CCAGTGGCCCTTTTGGCATAAGG - Intronic
906891231 1:49717342-49717364 CCATTCTGGCTTTTGTGAGATGG + Intronic
907062749 1:51447748-51447770 ACATTAGGCCTTGGGTCATATGG - Intronic
923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG + Intergenic
1064768368 10:18697934-18697956 CCATTCTGCTTTTTGACACATGG - Intergenic
1066060666 10:31721089-31721111 CCATTCCGCTTTGTGTCATCTGG + Intergenic
1067092743 10:43277615-43277637 TCAATCTGCCTTTTGTAATAGGG - Intergenic
1068614764 10:59101427-59101449 CTAATCTGCCTTTTGTTATAAGG - Intergenic
1073677122 10:105660994-105661016 CCATTTGGTCTTTTGCCCTAAGG - Intergenic
1077071155 11:673946-673968 CCCTTCGGCCTCTTTTCATATGG - Intronic
1093559435 12:20520751-20520773 CCATTCCTCCTTTTGCCACAGGG - Intronic
1094867533 12:34555136-34555158 CCATTCTGCCATTTGACATTTGG - Intergenic
1096411246 12:51378593-51378615 CTATTTGGCCTTTTCTCAAATGG - Intronic
1099140878 12:78974031-78974053 TCATTAGGCATTTTGTCATTGGG + Intronic
1100375651 12:94014003-94014025 CCATTGGGCCATTTGTCCTCAGG + Intergenic
1114076725 14:19165240-19165262 CCATGTGGGCTTTAGTCATAAGG - Intergenic
1114085438 14:19234328-19234350 CCATGTGGGCTTTAGTCATAAGG + Intergenic
1116394858 14:44435533-44435555 CCCTTGGGCCTTTTTTTATAAGG + Intergenic
1117049502 14:51846120-51846142 CCTTTCTGCCTTTTGACAAATGG - Intronic
1117051340 14:51863003-51863025 CCATTCAGCCATTGGCCATATGG - Intronic
1130730149 15:86483422-86483444 CCATTAGGCATTTTTTCCTAGGG - Intronic
1131464183 15:92642244-92642266 CCATTTGGCAGTTTGTCAAAAGG + Intronic
1143139502 17:4733303-4733325 CCATTTGCCCCTTTGTCCTAGGG - Exonic
1144665284 17:17098292-17098314 CCATTTGGCCTTTTGGAATTGGG + Intronic
1153622980 18:6997445-6997467 TCATTCTGCCTTTTGGGATAAGG - Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1166147036 19:40845014-40845036 CCATTCGGCCTTTTGTCATAGGG - Intronic
1166151191 19:40876911-40876933 CCATTAGGCCTTTTGTCTTAGGG - Intronic
1166179111 19:41094694-41094716 CCATTAGGCCTTTTGCCTTAGGG + Intronic
1166551615 19:43669273-43669295 CCTTTGGGCCTTTTGTAAAAGGG + Intronic
927211895 2:20644154-20644176 CCATTTGGCCTCTTGTGAAAAGG - Intronic
933558168 2:83857758-83857780 CCCTTCTGCCTTTTGCCATGTGG + Intergenic
938491323 2:131762745-131762767 CCATGTGGACTTTAGTCATAAGG - Intronic
938496239 2:131799581-131799603 CCATGTGGACTTTAGTCATAAGG + Intronic
940198663 2:151125730-151125752 CCATTCTGCCTGGTGTCAGACGG - Intergenic
948343642 2:237277008-237277030 CCATTCTGACTGGTGTCATATGG - Intergenic
1174916947 20:54663653-54663675 CTAATCTGTCTTTTGTCATAGGG - Intergenic
1175669681 20:60891188-60891210 CAATTCTGCCTATTGTCAAAAGG - Intergenic
1176708453 21:10131615-10131637 CCATGTGGACTTTAGTCATAAGG - Intergenic
1177540319 21:22484426-22484448 CCATTCTGACTTGTGTGATATGG + Intergenic
1180292534 22:10858865-10858887 CCATGTGGGCTTTAGTCATAAGG - Intergenic
1180495339 22:15888287-15888309 CCATGTGGGCTTTAGTCATAAGG - Intergenic
949768849 3:7556191-7556213 CTCTTGGGCCTTTTGTAATAAGG + Intronic
949771042 3:7578596-7578618 TCATTGGGCCTCTGGTCATAGGG - Exonic
951047318 3:18054683-18054705 CCATTCTGCCTGTTGTAAGATGG + Intronic
953200808 3:40777057-40777079 CCATTATGCATTTTGTCATATGG - Intergenic
953377051 3:42437410-42437432 CCATGCAGTCTTATGTCATATGG - Intergenic
960881961 3:122354381-122354403 CCATTCATCCATTTGTCATGTGG - Intergenic
962841284 3:139235082-139235104 TCATTCACCTTTTTGTCATATGG - Intronic
965840082 3:172894761-172894783 CCCTTGGGCCTCTTTTCATAAGG - Intronic
966389315 3:179435177-179435199 CCATACGGCCTCTTTTCAAAGGG + Intronic
967468449 3:189835269-189835291 CCATTTAGCCTTTTATCATTAGG - Intronic
972250226 4:37292340-37292362 CCCTTCAACCTTTTTTCATAAGG - Intronic
975468357 4:74735209-74735231 CCATTTGGCCTTTTGTGGCAGGG - Intergenic
976815606 4:89145179-89145201 CCATTCTGACTTTTGTGAAATGG + Intergenic
983354426 4:166637744-166637766 CTATTCTGCCTTTTGGAATAAGG - Intergenic
984355856 4:178655961-178655983 TCATGTGGCCATTTGTCATAGGG - Intergenic
987032125 5:13985920-13985942 CCATTCGGGATTTTTTCAGATGG + Intergenic
989459901 5:41685362-41685384 CCATTCTGCCTTTTCTGAGAGGG - Intergenic
994161643 5:96563310-96563332 CTAATCTGTCTTTTGTCATATGG + Intronic
995246539 5:109941434-109941456 CCATTCGGACTTCTTACATAAGG - Intergenic
995974127 5:118010041-118010063 CCATTTGGGCTTTTCTCCTATGG + Intergenic
1000949735 5:167466005-167466027 CCATTAGGTCTTTTTTCTTAAGG - Intronic
1003798044 6:9628461-9628483 CCATTAGGCTTTTTTTCCTAAGG - Intronic
1005337059 6:24807826-24807848 ACCTTCTGCCCTTTGTCATAGGG + Intronic
1010069156 6:71723096-71723118 CCAATCTGTCTTTTGTTATAGGG - Intergenic
1010178709 6:73058866-73058888 CCATTCTGACTTTTGTGAGATGG - Intronic
1012112674 6:95257047-95257069 CCATTCTGCCTTTTCTTACAAGG - Intergenic
1012958483 6:105596676-105596698 ACATTCTGCCTTTTGCCATCTGG + Intergenic
1013732805 6:113188777-113188799 CTATTCTGTCTTTTGTTATAGGG + Intergenic
1014561953 6:122901496-122901518 CCATGAGACTTTTTGTCATAGGG + Intergenic
1020571609 7:9870674-9870696 CCAATCTGACTGTTGTCATAAGG + Intergenic
1020762380 7:12284309-12284331 CTAATCTGTCTTTTGTCATAGGG + Intergenic
1024292918 7:47818554-47818576 CCATTGGGCCTTTTGGCTTTGGG - Intronic
1030252639 7:107464299-107464321 CCATACTGCCTTTTGCCTTAGGG + Intronic
1031508589 7:122619820-122619842 CTTTTCAGCCTTTTGACATAAGG - Intronic
1034936916 7:155205806-155205828 CCAGTCGGCTATTTGTCATAAGG + Intergenic
1035582838 8:750801-750823 CCATTAGGCCTTTTGAAATAGGG - Intergenic
1038711471 8:29950972-29950994 CCTTTCTTCCTTTTGTCAAAAGG - Intergenic
1038925187 8:32131003-32131025 CAACTCTGCCTTTTGCCATATGG - Intronic
1050283025 9:4072140-4072162 CCATTCTGTATTTTGTCTTAGGG + Intronic
1053645420 9:40117128-40117150 CCATGTGGACTTTAGTCATAAGG - Intergenic
1053760294 9:41346399-41346421 CCATGTGGACTTTAGTCATAAGG + Intergenic
1054326440 9:63715029-63715051 CCATGTGGACTTTAGTCATAAGG - Intergenic
1054539153 9:66258844-66258866 CCATGTGGACTTTAGTCATAAGG + Intergenic
1058336513 9:103836361-103836383 CCACTTGGCCTTTTGGGATAGGG - Intergenic
1059043282 9:110837829-110837851 CCATTCAAACTTTAGTCATAGGG + Intergenic
1062208597 9:135350863-135350885 CCATGCTGCATTTTGTCATCAGG - Intergenic
1202793214 9_KI270719v1_random:100584-100606 CCATGTGGACTTTAGTCATAAGG - Intergenic
1186508722 X:10114766-10114788 GCATTCGGCCTGTTGAGATAGGG + Intronic
1190509871 X:51163985-51164007 CCACTCGGCCTTTTGTCAGCCGG - Intergenic
1193668295 X:84351446-84351468 CCATTTGGCCTTTTCTTGTAGGG + Intronic
1196534395 X:116825044-116825066 CCATTAGGCTTTTTTTCCTAAGG - Intergenic