ID: 1166147201

View in Genome Browser
Species Human (GRCh38)
Location 19:40845896-40845918
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166147195_1166147201 8 Left 1166147195 19:40845865-40845887 CCGGGATCTGGGACAGGTGGGGA 0: 1
1: 1
2: 3
3: 37
4: 341
Right 1166147201 19:40845896-40845918 CAGTCGAAGGGGAATTTTGAGGG 0: 2
1: 0
2: 0
3: 5
4: 101
1166147193_1166147201 9 Left 1166147193 19:40845864-40845886 CCCGGGATCTGGGACAGGTGGGG 0: 2
1: 2
2: 2
3: 36
4: 363
Right 1166147201 19:40845896-40845918 CAGTCGAAGGGGAATTTTGAGGG 0: 2
1: 0
2: 0
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901677552 1:10895264-10895286 CAGGGAAAGGGGAATTTTTAAGG + Intergenic
907316655 1:53576849-53576871 CAGCCGAGGGGGACATTTGAGGG - Intronic
909715453 1:78701965-78701987 CATTGGAAGGGGAATTTGGGAGG + Intergenic
913355108 1:117912408-117912430 CAGTGGAAGTCAAATTTTGAGGG - Intronic
913424263 1:118709239-118709261 CAGTCAAAGGGATATTTGGAGGG + Intergenic
913743004 1:121870119-121870141 CATTCCAAGGGGAATTTTGGAGG - Intergenic
916393315 1:164357246-164357268 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
922228916 1:223668691-223668713 CAGTCTAAGGGGAATGTTTCTGG - Intergenic
1064498434 10:15940779-15940801 CAGCCAAAGTGGAATTCTGAAGG - Intergenic
1065145902 10:22767832-22767854 AAGTTGATGGGGAATTTGGAAGG + Intergenic
1065763181 10:29002223-29002245 CAGGCGAAGGGGACTTTGGGTGG + Intergenic
1074115111 10:110451124-110451146 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
1075132456 10:119751674-119751696 CAGTTTAAAGGGAATTTTGTTGG + Intronic
1083840715 11:65302597-65302619 CATTCTAAGGGGCAATTTGAAGG - Intronic
1084626470 11:70311654-70311676 CAGTTGAATGGCACTTTTGATGG + Intronic
1088006062 11:104942058-104942080 CAGACAAAGAGGAATTCTGAAGG - Intergenic
1092000316 12:5026295-5026317 CAGCCGAAGGGCAATTATAAAGG - Intergenic
1096220476 12:49825847-49825869 CAGGTGAAGGGGAATGTTGAAGG - Intronic
1097942447 12:65326362-65326384 CAATGGAAATGGAATTTTGATGG + Intronic
1099748377 12:86736953-86736975 CAGTTGATGGGAAAATTTGATGG - Intronic
1100121918 12:91378482-91378504 CAGAATAAGGGGAAGTTTGAGGG - Intergenic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1105939774 13:25137373-25137395 CAGTCAAAGGAGAATGCTGATGG + Intergenic
1109133390 13:58616594-58616616 CAATCAAAGTGTAATTTTGAAGG + Intergenic
1116561868 14:46390045-46390067 CAGTCGAAGGTGTGTTTTCAGGG + Intergenic
1123964611 15:25442483-25442505 TAGTTGAAGAGGAATTTGGAAGG - Intergenic
1124142882 15:27092957-27092979 CAGTTGAAAGGGAATTGAGAAGG + Intronic
1127390674 15:58502790-58502812 CAGTCAAAGAGCAATTTTTAGGG + Intronic
1133732822 16:8590691-8590713 CACTCGAAGGTGGATTTTGGAGG - Intergenic
1135158036 16:20071142-20071164 CAGTAAAATGGGAATTATGAGGG - Intronic
1135502716 16:23011196-23011218 CAGTGGAAGGGGAACTCTCAAGG + Intergenic
1137797814 16:51237095-51237117 ATGTCTATGGGGAATTTTGATGG - Intergenic
1145250162 17:21293145-21293167 CAGAAGAATGGGCATTTTGATGG + Intronic
1146794502 17:35771914-35771936 CTGTGGAAGGGGAATTGTTAGGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1156396157 18:36701822-36701844 CTGTCCAAAGGGACTTTTGAAGG + Intronic
1158837735 18:61348768-61348790 CATTCGGAGGGGAATTGGGAGGG + Intronic
1166147201 19:40845896-40845918 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1166151358 19:40877792-40877814 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1166155848 19:40910486-40910508 CAGGCTCAGGGGAGTTTTGAGGG + Intergenic
1166178956 19:41093809-41093831 CAGGCTCAGGGGAGTTTTGAGGG - Intronic
1166750149 19:45160683-45160705 CGGTGGAGGGGGAATTGTGAGGG + Intronic
925949714 2:8899133-8899155 CATTGGAAGGGCAATTTGGAAGG - Intronic
926757658 2:16249311-16249333 CAATGGAAGGGCAATTATGAGGG - Intergenic
926835616 2:17016239-17016261 CAGTGGAAAGGGGATTGTGAAGG + Intergenic
927385280 2:22525382-22525404 GAGGCAAAGTGGAATTTTGAAGG + Intergenic
927443850 2:23140672-23140694 CACTCGTAGGTGAATTTTAAAGG - Intergenic
940023540 2:149181125-149181147 CAGATGAAGGGGAATTGAGAGGG - Intronic
941463684 2:165800439-165800461 TGTTAGAAGGGGAATTTTGAAGG + Intergenic
943183918 2:184580498-184580520 AAGTTGAAGGGGAATATTCAAGG + Intergenic
948643626 2:239390582-239390604 CACTCTAAGGGGATTTTTGGGGG - Intronic
1171167287 20:22983115-22983137 TAGTAGAAAGAGAATTTTGAGGG - Intergenic
1171328547 20:24317738-24317760 CATCTGAAGGGGCATTTTGAAGG - Intergenic
1174954285 20:55079743-55079765 CAGTAGAAGGGGGATTTTCCAGG + Intergenic
1175989549 20:62781025-62781047 CAGTCTAAGGAGAATTCTAAGGG + Intergenic
1176372478 21:6070673-6070695 CAGGCTAAGGGGATTTCTGACGG + Intergenic
1177532486 21:22379105-22379127 CAGTTAAATGGGAATTTTGTTGG + Intergenic
1179750998 21:43467572-43467594 CAGGCTAAGGGGATTTCTGACGG - Intergenic
949487870 3:4557528-4557550 CAGTCAAAAGGGAATTATCATGG - Intronic
955556647 3:60145072-60145094 TAGTTGAAGGGGAATACTGAGGG - Intronic
956394251 3:68808237-68808259 CAGTGGAAGGGTCATTTTTAGGG - Intronic
957525722 3:81376283-81376305 AAGTCAAAGGGGCATTTGGATGG + Intergenic
959099360 3:101992726-101992748 CAGGTGAAAGAGAATTTTGAGGG + Intergenic
959364633 3:105441657-105441679 CATTGGAAGGTGAATTATGAAGG - Intronic
961004429 3:123395384-123395406 CAGGCAGAGGGGGATTTTGATGG - Intronic
961200367 3:125040743-125040765 TACTCAAAGGGGAATTTTAAAGG - Intronic
962038972 3:131684786-131684808 CAGTCCAAGAGGGATTTTGTAGG - Intronic
964064683 3:152563399-152563421 CATTGGAAGGGCAATTTGGAAGG + Intergenic
964794911 3:160486183-160486205 CAGTCTAAGGGGAAGTTTCTTGG + Intergenic
964795258 3:160489883-160489905 AGGCCCAAGGGGAATTTTGAGGG - Intergenic
975147663 4:70988222-70988244 CATTCCAAGGGAAATATTGATGG + Intronic
979582103 4:122372813-122372835 CAGTCATGGGGGAATGTTGAAGG - Intergenic
979968205 4:127102848-127102870 CAATGGAAGAGGAAATTTGAAGG - Intergenic
991258588 5:64642598-64642620 CAGTTGAAGAGGAATCTGGAAGG - Intergenic
995583256 5:113622224-113622246 CATTGGAAGGGCAATTTGGAAGG - Intergenic
996547868 5:124699859-124699881 GAGTGGATGGGGAATATTGAGGG - Intronic
997096086 5:130913172-130913194 TAGTTGAAGGAGAATTTTGCTGG - Intergenic
1002508115 5:179694662-179694684 AAGTCGAAAGGGAAGTTTGATGG + Intronic
1003794661 6:9587417-9587439 TAGTCTAAGGGGACTTCTGATGG + Intergenic
1004569941 6:16835289-16835311 CAGTCTAGGGTGAATTTAGAGGG + Intergenic
1007319934 6:41020738-41020760 AAGCCAAAGGGGAATTTTCAGGG + Intergenic
1008673930 6:53799451-53799473 CATAGGAAGGGGAATTATGACGG - Intronic
1010379342 6:75207429-75207451 CAGTCGAAAGGCAAGTTTGGAGG - Intergenic
1016876731 6:148873042-148873064 CAGTTGATGGGAATTTTTGAAGG - Intronic
1022077119 7:26982865-26982887 AAGTCGAAAGGAAAGTTTGATGG - Intronic
1025226590 7:57170344-57170366 AAGTCCATGGGCAATTTTGAGGG - Intergenic
1028528310 7:91809893-91809915 CAGTATGTGGGGAATTTTGAAGG + Intronic
1028765552 7:94554057-94554079 CAGCGGAAGGAGGATTTTGAAGG + Intronic
1032002194 7:128272408-128272430 CAGTCGAAGGGGATTGGAGAGGG + Intergenic
1035588628 8:796394-796416 CAGTCGCAGGGAAATCCTGAGGG - Intergenic
1035729372 8:1843699-1843721 CAGGCTAAGGGGAATCTTAAGGG - Intronic
1037393170 8:18416072-18416094 CAGCTGAAGGGGAATTTTGCCGG - Intergenic
1037637670 8:20714859-20714881 CAGTGGAACAGGAATTTTGGGGG + Intergenic
1037658796 8:20909748-20909770 CAGGCAGAGGGGAATTTTCAAGG - Intergenic
1041905368 8:63027070-63027092 GAGGCTAAGGGTAATTTTGAAGG + Intronic
1046847264 8:118931641-118931663 CATACGAAGAGGAATTTTAAGGG + Intronic
1049930277 9:449509-449531 CAGTCAAAGGGGGATTTGTAAGG - Intronic
1052070386 9:24074526-24074548 CACTCCAAGGGGAATTGTAAGGG - Intergenic
1053761891 9:41353754-41353776 GAGGCGAAGGGGAGGTTTGAGGG - Intergenic
1185754937 X:2645674-2645696 CAGTCAAAGGGCCATTTTCAAGG + Intergenic
1186433660 X:9525262-9525284 AAGTCTAATGGGAATTTGGAAGG - Intronic
1186662994 X:11687886-11687908 AAGCAGAAAGGGAATTTTGAGGG - Intergenic
1188411696 X:29880684-29880706 CTGTCAAAAGGGAAGTTTGATGG - Intronic
1193062106 X:77217857-77217879 CAGTCGAATGTGGTTTTTGAAGG - Intergenic
1198260641 X:134961807-134961829 AAGTCGAAAGGAAAGTTTGATGG - Intergenic
1199434778 X:147801372-147801394 GAGTCGAGGAGGAATTTAGAAGG + Intergenic
1199773179 X:150987792-150987814 AAGTCGAAAGGAAAGTTTGATGG + Exonic