ID: 1166147616

View in Genome Browser
Species Human (GRCh38)
Location 19:40848380-40848402
Sequence CTGCGGGTATGGCGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166147616 Original CRISPR CTGCGGGTATGGCGGGAGAA GGG Intronic
902108848 1:14060970-14060992 CTGCTGGTGTGGGAGGAGAAGGG - Intergenic
902471114 1:16647986-16648008 CTGCGGGTGAGACGGGAGGAGGG + Intergenic
902487689 1:16759459-16759481 CTGCGGGTGAGACGGGAGGAGGG - Intronic
902810720 1:18886377-18886399 CTGCTGATATGGCGGGGGCAGGG - Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906460687 1:46033550-46033572 CTGTGGGTAGGGCTGCAGAATGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
911069662 1:93822646-93822668 CTTTGGATATGGCTGGAGAAAGG + Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
919452248 1:197786372-197786394 GTGTGGGTATGGGGTGAGAAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923698805 1:236281365-236281387 CTGGGAGTGTGGCGGGAGATGGG - Intronic
923805254 1:237250657-237250679 CTGGGAGTTTGGCGGGTGAAAGG - Intronic
924409176 1:243785167-243785189 CTGCGGCTGAGGCAGGAGAATGG - Intronic
1064297221 10:14089443-14089465 CTGCGGGGAGGGCGGGGGAGAGG - Intronic
1065102113 10:22341048-22341070 CAGCGGGTGTAGCGGGAGGAAGG - Intergenic
1067477800 10:46578154-46578176 TTGCGGGAAAGGCGGGAGTAAGG - Intergenic
1067495602 10:46757495-46757517 CTGCGGGAACGGCGGTAGATGGG + Intergenic
1067599051 10:47582893-47582915 CTGCGGGAACGGCGGTAGATGGG - Intergenic
1067616937 10:47763633-47763655 TTGCGGGAAAGGCGGGAGTAAGG + Intergenic
1067948714 10:50709478-50709500 CTGCGGGAACGGCGGTAGATGGG - Intergenic
1069941045 10:71955538-71955560 ATGCGGATATGGGGGTAGAAAGG - Intergenic
1070328646 10:75403315-75403337 CTGCGGGGATGGCGGCAGGTGGG - Intergenic
1073296098 10:102439745-102439767 CTGAGGCTAAGGCAGGAGAATGG + Intergenic
1074065342 10:110008164-110008186 CAGAGGGTAGGGCGGGAGAAGGG - Exonic
1083766660 11:64844681-64844703 CAGCGGGGAGGGCGGGAGAGGGG - Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1095710120 12:45279210-45279232 CTGAAGGTAGGGCAGGAGAATGG - Intronic
1097187315 12:57202783-57202805 GTGGGGGTATGGTGGGAGCACGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1102199478 12:111047498-111047520 CTGGGGCTAGGGCTGGAGAATGG + Intronic
1103725337 12:122994929-122994951 CTGCTGGAATGGCGTGAGCAGGG + Exonic
1118405277 14:65416886-65416908 CAGAGGCTAAGGCGGGAGAATGG - Intronic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1120193286 14:81459009-81459031 GGGAGGGTAAGGCGGGAGAATGG - Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1127547156 15:60002364-60002386 CTGGGGGTATGGCTCGAGAAGGG - Intergenic
1128110287 15:65071818-65071840 CTGGGGGCAGGGCTGGAGAAGGG - Intronic
1130979481 15:88803155-88803177 CTCCGGGGCTGGCGGGAGGAAGG - Intergenic
1132556340 16:574354-574376 CTGCGGCTGTGCCGGGAGAGAGG + Exonic
1133283001 16:4677591-4677613 CTGCGGGATGGGCGGGAGAGGGG + Intronic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1135985762 16:27182825-27182847 ATGGGGGTAGGGAGGGAGAAAGG + Intergenic
1136037201 16:27549585-27549607 CTGGGGGCAGGGCGGGGGAATGG - Intronic
1136570001 16:31090997-31091019 GTGCGGGTATGGCAGGAGGAGGG + Exonic
1140995917 16:80259489-80259511 CTGCCGGAATGGCGGGATAAGGG - Intergenic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1146339743 17:32008219-32008241 CGGCGGGGTTGGCGGGAGATCGG - Intronic
1149526362 17:57359092-57359114 CTCCGGGAGTGGCGGGAGAAAGG - Intronic
1149962669 17:61129147-61129169 CTGAGGGTATGGAGTAAGAAAGG + Intronic
1152629415 17:81403385-81403407 CTGGGGTTATTGTGGGAGAAAGG + Intronic
1155177297 18:23312188-23312210 CTGTGGGTATGGTGGGGGACAGG - Intronic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1159969212 18:74628397-74628419 CTGCGGGTAGGCAGGCAGAATGG - Intronic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1161967596 19:7556943-7556965 CTGCGGGGATGGCGTGAGGGGGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1164025577 19:21348722-21348744 CTGAGGGTACTGCAGGAGAACGG + Intergenic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165089105 19:33373538-33373560 CGGCGGGTGTGGCGGGAGCAGGG - Exonic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
1167252377 19:48406756-48406778 ATGCGGGCATGGCGGGGGCACGG + Intronic
1167322470 19:48805636-48805658 CAGGGGGGATGGCGGGAGAGGGG - Intronic
1167616289 19:50535984-50536006 CTGCGGGTGGGGTGGGAGAGTGG + Intronic
1202703511 1_KI270713v1_random:4781-4803 CTGCGGGTGAGACGGGAGGAGGG + Intergenic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
932229185 2:70068453-70068475 CTGTGAGTCTGGCTGGAGAACGG + Intergenic
934761873 2:96861038-96861060 CTGCGGGAAGAGCTGGAGAAAGG - Exonic
935420675 2:102865833-102865855 CTGCAGGAATGCCGGGGGAAGGG + Intergenic
935528241 2:104199368-104199390 CTTAGGGTATGACAGGAGAAGGG - Intergenic
938636539 2:133233857-133233879 CTGTAGGTATGTGGGGAGAAGGG - Intronic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG + Intronic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
1172178697 20:32987636-32987658 CAGGGGGGATGGCGGGAGATGGG - Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1174556398 20:51398432-51398454 CTCAGGGTTGGGCGGGAGAAGGG - Intronic
1176206201 20:63889544-63889566 CCGGGGGTAGGGCGGGAGGAAGG - Intronic
1178534086 21:33398288-33398310 CTGTGGGTATGGCAGGAGTGGGG + Intergenic
1179230688 21:39501246-39501268 CTGCTGGTCTCACGGGAGAAAGG - Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1184895328 22:47403311-47403333 CACCAGGTATGGCAGGAGAATGG + Intergenic
950379489 3:12599353-12599375 CTGCTGCTATGGAGGGAGCATGG - Intronic
953099692 3:39811771-39811793 CTGCGTGTATGGTGGTAGAAGGG + Intronic
954298318 3:49686252-49686274 CTGCGGGTGAGACGGGAGGAAGG - Intronic
968722196 4:2215990-2216012 CTGGGGCTATGGCCAGAGAAGGG - Intronic
975578485 4:75886279-75886301 CGGCGGGGATGGCAGGAGACTGG - Intronic
981085727 4:140681430-140681452 CTGAGTGGATGGCAGGAGAAAGG + Intronic
983604082 4:169565793-169565815 CTGCGGGGTTGGGGGAAGAATGG + Intronic
990889026 5:60628903-60628925 CTGCTGAAATGGTGGGAGAAAGG + Intronic
995636234 5:114194852-114194874 TTGGGGGTATGGCATGAGAAAGG + Intergenic
998496911 5:142598798-142598820 CCACGGCTATGGTGGGAGAAGGG + Intronic
1000751719 5:165103362-165103384 CTGGGGGTATTGCGGGCAAATGG - Intergenic
1001110268 5:168890033-168890055 CTGAGGCTAAGGCAGGAGAATGG + Intronic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1006638269 6:35475319-35475341 CTGCAGGTATGGGGGCAGCAGGG - Exonic
1007975696 6:46098978-46099000 CTGCGGGGGTGGGGGTAGAAGGG + Intergenic
1008542570 6:52558082-52558104 GTGGGGGTAGGGCAGGAGAAGGG - Intronic
1010725773 6:79331017-79331039 TTGGGGGGATGCCGGGAGAAAGG - Intergenic
1014300464 6:119675499-119675521 CTACAGCTATGGGGGGAGAATGG + Intergenic
1017011196 6:150064855-150064877 CTGGGGGTAGGAAGGGAGAAGGG + Intronic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1018837214 6:167494116-167494138 GGGCGGGGAAGGCGGGAGAAGGG + Intergenic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1035166476 7:156993354-156993376 GTCCGGGTATGGCGGGAGCTGGG + Intergenic
1036157712 8:6358044-6358066 CAGAGGCTAAGGCGGGAGAATGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037915386 8:22769859-22769881 CTGCAGCAATGGCGGGAGGAAGG - Intronic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049803252 8:144527780-144527802 CTGCGGGTCTGGGGGATGAAGGG + Exonic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1056053556 9:82796490-82796512 CTGAGGGTAGGGTGGAAGAAGGG + Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057644073 9:96856460-96856482 CTCTGGGGAGGGCGGGAGAAAGG - Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1189277521 X:39797546-39797568 CTGCAGGTCTGGCTGGAGAAAGG + Intergenic
1197338984 X:125243184-125243206 CAGAGGCTAAGGCGGGAGAATGG + Intergenic
1198682064 X:139193576-139193598 CTGCTGGGAGGGCGGAAGAAAGG + Intronic
1199912994 X:152307925-152307947 CAGAGGGTTTGGCGTGAGAATGG + Intronic