ID: 1166151757

View in Genome Browser
Species Human (GRCh38)
Location 19:40880245-40880267
Sequence CTGCGGGTGTGGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 572}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166151757 Original CRISPR CTGCGGGTGTGGAGGGAGAA GGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900335651 1:2161753-2161775 GTTCGGGTCTGGATGGAGAAGGG - Intronic
900460942 1:2801880-2801902 ATGGGGGTGTTGGGGGAGAAGGG + Intergenic
900500804 1:3003639-3003661 CTGCAGCTGTGGAGGCAGCACGG - Intergenic
900661995 1:3789408-3789430 CTGCGTGTTTGCAGGCAGAAAGG - Intronic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
900907325 1:5568718-5568740 CTCCTGGGGTGAAGGGAGAAGGG + Intergenic
901490540 1:9594334-9594356 CAGGGGGTGTGGGGTGAGAAGGG + Intronic
902108848 1:14060970-14060992 CTGCTGGTGTGGGAGGAGAAGGG - Intergenic
902471114 1:16647986-16648008 CTGCGGGTGAGACGGGAGGAGGG + Intergenic
902487689 1:16759459-16759481 CTGCGGGTGAGACGGGAGGAGGG - Intronic
903040060 1:20522805-20522827 CTGCCGGTGTGGATTGGGAAAGG + Intergenic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903187895 1:21639697-21639719 GTGCGGATGTGGAGTGAGCAAGG + Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904336284 1:29800437-29800459 GTCTGGGTGTGGAAGGAGAAGGG - Intergenic
904521736 1:31101184-31101206 CTGTGCGTGTGCTGGGAGAAAGG - Intergenic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905630152 1:39514096-39514118 CTGAGGAGGTGGAGGGAGACAGG + Intronic
905667608 1:39772094-39772116 CTGAGGAGGTGGAGGGAGACAGG - Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905904829 1:41611065-41611087 CTCAGGGTGTGGGGGCAGAAGGG + Intronic
906273795 1:44501207-44501229 CTGGGGGTGGGGAGTGGGAAGGG + Intronic
906306981 1:44725598-44725620 TTGTGTGTGTGGAGGGGGAAGGG + Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
907030468 1:51166161-51166183 CTGAGGGTGTGGAGGGGGTGGGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
908785335 1:67729755-67729777 CTGCCACTGGGGAGGGAGAATGG - Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909893595 1:81037690-81037712 ATGAGGGTGTGGTGGGGGAAGGG - Intergenic
910263689 1:85315912-85315934 ATGAGGGTTTGGAGGGGGAAGGG + Intergenic
910745965 1:90575283-90575305 CAGGGGGTGGGGAGGGGGAAGGG + Intergenic
911780570 1:101870734-101870756 CTGTGGGGGTGTAGGCAGAAAGG + Intronic
912643385 1:111368844-111368866 CAGCTGGTGTGGAGGCACAATGG - Intergenic
912685172 1:111756251-111756273 CGGGGGGTGGGGTGGGAGAAGGG + Intronic
912808854 1:112778313-112778335 CAGAGGGTGTGGAAGGAGTAAGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913264051 1:117027173-117027195 CAGCGGGTTTGGAGGCATAAGGG - Intronic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915327067 1:155086093-155086115 GTGCGGGTGGGGAGAGAGGAGGG - Intronic
916107423 1:161441766-161441788 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916109008 1:161449184-161449206 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916110595 1:161456565-161456587 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916112181 1:161463975-161463997 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916113768 1:161471356-161471378 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917332455 1:173895596-173895618 CTGGAGGTGTAGAGGTAGAATGG - Exonic
917530292 1:175829148-175829170 CGGCGGCTGGGGAGAGAGAAAGG - Intergenic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
919770163 1:201153659-201153681 GTGCGGGTGAGGAGTGAGGAAGG - Intronic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
922686155 1:227640112-227640134 CTGAGGATGTGAAGGGGGAAAGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922769135 1:228172735-228172757 CTGCTGGTGGGGAGGCAAAACGG - Intronic
923076976 1:230618410-230618432 GTGCAGGAGTGGAGGAAGAAGGG - Intergenic
923240726 1:232082958-232082980 CTGCAGATGTGCTGGGAGAATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923698805 1:236281365-236281387 CTGGGAGTGTGGCGGGAGATGGG - Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924409176 1:243785167-243785189 CTGCGGCTGAGGCAGGAGAATGG - Intronic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063455776 10:6181899-6181921 CAGGGGCTGGGGAGGGAGAATGG + Intronic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1064091045 10:12385145-12385167 CTGCTGGTGTGGATGTAAAATGG + Intronic
1064286798 10:13998671-13998693 GATTGGGTGTGGAGGGAGAAAGG - Intronic
1064553010 10:16521277-16521299 CTGCGGCTGGGGAGGGAGCGCGG + Exonic
1065102113 10:22341048-22341070 CAGCGGGTGTAGCGGGAGGAAGG - Intergenic
1065239762 10:23694214-23694236 CCGCGGGGGTGGAGGTTGAAAGG + Intergenic
1065883601 10:30058806-30058828 CTGCGCGTGGGATGGGAGAAGGG - Intronic
1065908171 10:30278116-30278138 CTGTCGGTGGGTAGGGAGAAAGG + Intergenic
1067222453 10:44353773-44353795 CATCGGGTGTGGAGGTAGAAAGG - Intergenic
1067668867 10:48301804-48301826 CAGTGGGTGTGGATGGAGAGAGG + Intergenic
1069024851 10:63528513-63528535 CTGCTGTTGAGGAGGGACAAGGG - Intronic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1069941870 10:71962171-71962193 TTGCGGGGGTGGTGGGAGACGGG + Intergenic
1069959765 10:72072821-72072843 ATGAGGGTGTGGAGGGACACAGG + Intronic
1070764911 10:79050859-79050881 CTGGGGGTGGGTGGGGAGAAGGG - Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1072124452 10:92433004-92433026 ATTCGGGGGTGGAGGGACAAGGG + Intergenic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073539253 10:104305071-104305093 CTGCAGTTGGGGAGGGAGATTGG + Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074305954 10:112278709-112278731 GTGGGGGTGAGGAGGGAGAGGGG + Intergenic
1074436950 10:113442351-113442373 CTGAGGTAGTGGAGAGAGAAAGG - Intergenic
1075262468 10:120975195-120975217 CTGCGGGTGGGAAGGTAGAATGG + Intergenic
1075479032 10:122763528-122763550 GTGCGGATGTGGGGGTAGAAAGG + Intergenic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076067426 10:127459827-127459849 CTGTGGGTGAGAGGGGAGAAAGG + Intergenic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076838442 10:133032819-133032841 CTGCAGGTGTGCAGAGAGCAGGG + Intergenic
1076941125 10:133609754-133609776 GTGCGGATGTGGGGGTAGAAAGG - Intergenic
1077292430 11:1804137-1804159 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292448 11:1804187-1804209 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292454 11:1804203-1804225 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292472 11:1804253-1804275 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292478 11:1804269-1804291 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292484 11:1804285-1804307 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077423033 11:2461834-2461856 CTGGGTGGGTGGAGAGAGAAAGG + Intronic
1077442207 11:2574151-2574173 CTGCAGCTGTGGGGGGAGATGGG - Intronic
1077458509 11:2695701-2695723 CTGCAGGTGGGGACGGAGACAGG - Intronic
1077700690 11:4439319-4439341 TTACAGGTGTGGAGGGAGAGAGG + Intergenic
1078159413 11:8827958-8827980 CTGGAGGTGGGGAGGGGGAACGG + Intronic
1078638002 11:13069679-13069701 CAGGGGGTGGGGAGGAAGAAAGG + Intergenic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1081207351 11:40291677-40291699 GTGCGTGGGTGGAGGGAGAAAGG - Intronic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1081340564 11:41922181-41922203 CTAAGGGTTTGAAGGGAGAAGGG + Intergenic
1081576706 11:44323167-44323189 CTGCTGGGGAGAAGGGAGAAGGG - Intergenic
1082833824 11:57638391-57638413 CAGGGAGTGTGGAAGGAGAAAGG + Intergenic
1082834173 11:57639769-57639791 CTTAGGGAGTGCAGGGAGAAAGG - Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083312649 11:61792688-61792710 TTTCGGGTGTAGAGGGAGCAGGG + Exonic
1083777088 11:64899376-64899398 CAGCGGGTGTGCAGGAAGAGGGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084324718 11:68393415-68393437 CTGCCGGTGGGGATGCAGAACGG - Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1086166273 11:83782589-83782611 CTGCAGGTGGAAAGGGAGAAAGG + Intronic
1086341811 11:85855056-85855078 GGGCGGGTGGGGAGGGAGTAGGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1089346574 11:117795403-117795425 CTGCGGGGGCGGAGGGAGGCAGG + Intronic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089631323 11:119786412-119786434 GTGATGGTGTGGATGGAGAAAGG + Intergenic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090005520 11:122998943-122998965 CTGCTGTTGTGGTGGGAGCAGGG - Intergenic
1091294080 11:134460278-134460300 CTGGGGGTGGGGAGGAACAAAGG + Intergenic
1091339848 11:134801715-134801737 ATGCGGGTGGGGTGGGGGAAGGG + Intergenic
1091816963 12:3446065-3446087 CTGAGGGTGGGGAGGGGGAGTGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091973649 12:4809074-4809096 CTGCGGGGGTGGAGGGGGTGTGG + Intronic
1093112667 12:15170332-15170354 CTGGGTGTGTGTAGGGGGAAGGG + Intronic
1093414720 12:18907074-18907096 CTGTGGGTGGGGAGAGAGAGGGG - Intergenic
1096258579 12:50077342-50077364 CTGCCTGTGTGGGGGGAGACTGG + Exonic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1100259001 12:92914125-92914147 CTGAGGGTGTGGTGGGGGTAGGG - Intronic
1100767266 12:97881066-97881088 CTGAGGAGGTGGAGTGAGAATGG - Intergenic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1103240004 12:119405141-119405163 CTGGGGGTGTGCACGGAGACAGG - Intronic
1103358857 12:120342097-120342119 TTGCGGGGGTCGAGGGGGAAGGG + Exonic
1103621951 12:122192461-122192483 CTTCTGATGTGGAGGGAGATGGG - Intronic
1103705080 12:122867134-122867156 CGGCTGGTGTGGAGGGAGCCGGG + Exonic
1104463735 12:128974100-128974122 CTGTGCGTGTGGAGGGGGAGAGG + Intronic
1104680999 12:130751854-130751876 CTATGGGTGTGGACAGAGAAGGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105259647 13:18769515-18769537 GGGCGGGTGTGGAAGGAAAAGGG - Intergenic
1105262323 13:18788832-18788854 GGGCGGGTGTGGAAGGAAAAGGG - Intergenic
1105686881 13:22792912-22792934 CTCGGGATGTGGAGGGAGAAAGG + Intergenic
1105755347 13:23458660-23458682 CTAGGAGTGTAGAGGGAGAATGG - Intergenic
1105900150 13:24746311-24746333 GTGGGGGTGCGCAGGGAGAATGG + Intergenic
1107838932 13:44435857-44435879 CGGCAGCCGTGGAGGGAGAAAGG - Intronic
1108800115 13:54084531-54084553 CAGGGAGTGTAGAGGGAGAAGGG - Intergenic
1109993846 13:70095816-70095838 TGGGGGGGGTGGAGGGAGAAGGG - Intronic
1110361285 13:74628622-74628644 ATGCAGTTGTGGAGGCAGAATGG + Intergenic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1111797045 13:92935064-92935086 ATGAGGATTTGGAGGGAGAAGGG + Intergenic
1112186848 13:97136021-97136043 ATGCGTGTGGGGAGGGTGAAGGG - Intergenic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113740959 13:112712130-112712152 CTCAGGGTGGGGAGGGAGAACGG - Intronic
1113741380 13:112714463-112714485 CGGGGAGTGAGGAGGGAGAAAGG - Intronic
1114237452 14:20835195-20835217 CTGAGGGTTTGAAGGGGGAAGGG + Intergenic
1114532221 14:23403210-23403232 CGGAGTGAGTGGAGGGAGAAGGG + Intronic
1114714984 14:24815603-24815625 CTACGTGTGTGGGGGAAGAAAGG - Intronic
1114812985 14:25922521-25922543 CTGCTGGTGTGAATGTAGAATGG - Intergenic
1117297533 14:54393447-54393469 CGGGTGGTGTGGAGGGAGAGCGG + Intergenic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121923663 14:97907542-97907564 CAACGGGTGGGGATGGAGAATGG - Intergenic
1122179874 14:99947130-99947152 GTTGGGGTGTGGAGAGAGAAAGG + Intergenic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1124667399 15:31605182-31605204 GTGTGGGTGTGCAGGGGGAATGG + Intronic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1127012281 15:54643678-54643700 CTGCTGCTGGGGATGGAGAAGGG - Intergenic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1129227614 15:74179147-74179169 CTCCAGGTGTGGAGGTAGGAAGG - Intergenic
1129606603 15:77028169-77028191 CTCCAGGGGTGGAGGGAGGAGGG + Intronic
1130182297 15:81642861-81642883 GTGCGTGTGTGTAGGGAGGAGGG - Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130540174 15:84816778-84816800 CTGGGGGTGTTGGGGGAGACAGG + Exonic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1131772753 15:95758041-95758063 CTGTTGGTGGGTAGGGAGAAAGG + Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132556340 16:574354-574376 CTGCGGCTGTGCCGGGAGAGAGG + Exonic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132745563 16:1434794-1434816 CTCCGGCTGTGGAGTGAGGAGGG - Exonic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133635010 16:7656949-7656971 CTGGGGGTGTGGGTGGAGGAGGG - Intronic
1133819965 16:9227265-9227287 CTGCGGGGGTGGGGGTAAAATGG + Intergenic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1135686098 16:24499471-24499493 GTGCGTGTGTGGAGGAAGGAAGG - Intergenic
1135985762 16:27182825-27182847 ATGGGGGTAGGGAGGGAGAAAGG + Intergenic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1138560781 16:57799904-57799926 CTGAGCCTGTGGAGGGAGAAGGG + Intronic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139616463 16:68097179-68097201 TTGGAGGTGGGGAGGGAGAAAGG + Intronic
1140196384 16:72859029-72859051 CAGAGGGTGTGGAGGGAGCCTGG - Intronic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1141163938 16:81647906-81647928 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141163950 16:81647938-81647960 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141163974 16:81648002-81648024 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141885335 16:86888038-86888060 CTGCTGGGGTGGAGCGTGAAGGG - Intergenic
1142501549 17:335945-335967 CCCCCGGCGTGGAGGGAGAACGG + Intronic
1143102434 17:4511870-4511892 CTGGGGGTGTGGAAGGAGTGGGG - Intronic
1143165491 17:4895358-4895380 CTGCTGGTGGGCACGGAGAACGG + Exonic
1143583193 17:7838288-7838310 CTGCTGGTGGGGAGGGAGGGAGG + Intergenic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1145814347 17:27784836-27784858 CTGGGGGTGTGAACGGGGAATGG - Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146329497 17:31916369-31916391 CGGAGGCTGTGGAGGGAGAATGG - Intergenic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1147191322 17:38739684-38739706 TTGGGGGTGTGGAGAGAGAGAGG + Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1148442938 17:47721144-47721166 CTGGAGGGGTGGAGGGGGAAGGG + Intergenic
1148785871 17:50145969-50145991 CTGCAGTTGTGGAGGGAGAGCGG - Intronic
1148829603 17:50422756-50422778 TTGGGGGTGTGGTGGGGGAATGG - Intergenic
1149526362 17:57359092-57359114 CTCCGGGAGTGGCGGGAGAAAGG - Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149654029 17:58300997-58301019 CTGGGGTTGTGGAGGAAGATGGG - Intergenic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1149962669 17:61129147-61129169 CTGAGGGTATGGAGTAAGAAAGG + Intronic
1150822920 17:68450247-68450269 CTGAGGACGTGGTGGGAGAAGGG + Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1151424843 17:74024358-74024380 CTGCGGGGTGGCAGGGAGAAAGG - Intergenic
1151580466 17:74974779-74974801 GAGCGGGTGTGGAGGGAAAGAGG + Intergenic
1151747269 17:76018300-76018322 CTGGGGCTGGGGAGGGAGAGAGG - Intronic
1151966497 17:77434292-77434314 CTGCGGGTGGACAGGGTGAACGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152599201 17:81253036-81253058 CTGGGGGTGCGGATGGGGAAGGG - Intronic
1152611573 17:81317450-81317472 CTGGGGGTGTGGATAGAGTAGGG + Intronic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1153276535 18:3373349-3373371 CTGCGGGTGTACAGGAAGCACGG + Intergenic
1154133582 18:11757389-11757411 CTCTGGCTGTGGATGGAGAACGG + Intronic
1155167104 18:23240349-23240371 CTGTGTGTGTGTAGGGGGAAGGG - Intronic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1156441413 18:37192192-37192214 TTGCGTGTGTGGAGGGGCAAGGG + Intronic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1158452590 18:57580530-57580552 CTGCTCCTGTGGAAGGAGAAGGG + Intronic
1159128444 18:64252690-64252712 CAGCGGGCTTGGAGGGAGCATGG + Intergenic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1159969212 18:74628397-74628419 CTGCGGGTAGGCAGGCAGAATGG - Intronic
1159989114 18:74881586-74881608 AGGCGGGTGGGGAGGGAGACAGG - Intronic
1160066632 18:75581495-75581517 CGGTGGGTGTGGGGAGAGAAAGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160582271 18:79890466-79890488 CTGCCAGTGGGGAGGGGGAAGGG - Intronic
1161088726 19:2347343-2347365 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088756 19:2347750-2347772 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088762 19:2347834-2347856 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088787 19:2348196-2348218 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088903 19:2350225-2350247 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088907 19:2350315-2350337 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088911 19:2350407-2350429 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161271740 19:3393321-3393343 CTGCCGGAGGAGAGGGAGAAGGG + Intronic
1161410324 19:4113383-4113405 CTGAGGGTGTGCAAGGGGAAAGG + Intronic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1161623002 19:5309128-5309150 CTCCGGGGGTGGAGAGAGAAGGG + Intronic
1163077521 19:14907880-14907902 CTGGGGCAGTTGAGGGAGAAGGG + Intergenic
1163231438 19:16005751-16005773 CTGCGGGGGTGAGGGCAGAAGGG - Intergenic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1163648127 19:18501831-18501853 CTGCGGGTGGGCAGGAAGGAGGG + Intronic
1164534790 19:29077007-29077029 CTGAGTGTGTGGTGGGGGAAAGG - Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165089105 19:33373538-33373560 CGGCGGGTGTGGCGGGAGCAGGG - Exonic
1165706898 19:37982769-37982791 ATGTGGCTGTGGAGGGAGAGAGG + Intronic
1165806359 19:38583526-38583548 GTGGGGGTGGGGAGGGAGCATGG - Intronic
1165961191 19:39535789-39535811 CTGCATGTGTGCAGGGAGACTGG + Intergenic
1166077319 19:40421220-40421242 CTGCGGGTGCGCATGGAGAGAGG - Intergenic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167616289 19:50535984-50536006 CTGCGGGTGGGGTGGGAGAGTGG + Intronic
1202703511 1_KI270713v1_random:4781-4803 CTGCGGGTGAGACGGGAGGAGGG + Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925705548 2:6681531-6681553 CTGCGGCTGTTGTGGGAGATGGG - Intergenic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925851966 2:8090740-8090762 CAGCGGGTTTGGAGGGAGCCCGG - Intergenic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928625537 2:33135966-33135988 CTGGGGGGGTGGTAGGAGAAGGG + Intronic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
930096283 2:47569538-47569560 CGCCGAGGGTGGAGGGAGAAGGG + Intronic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
932322183 2:70830403-70830425 CTAAGGGAGTGGAAGGAGAAGGG + Exonic
932336663 2:70935684-70935706 TGGAGGATGTGGAGGGAGAAGGG - Intergenic
932480068 2:72033726-72033748 CGGCTGGAGAGGAGGGAGAAGGG - Intergenic
932808019 2:74799580-74799602 CTGTGGGTGGGGACAGAGAAAGG + Intergenic
934064899 2:88331452-88331474 CAGCAGGTGGGGAGAGAGAAGGG - Intergenic
934659136 2:96133847-96133869 CTTCGGGTGGGGAGGTGGAAGGG + Intronic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935520358 2:104096745-104096767 GTGGGAGGGTGGAGGGAGAAAGG - Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
937218064 2:120325163-120325185 CAGCTGTTGTGCAGGGAGAAGGG + Intergenic
939428448 2:142071816-142071838 CTGAGGTTTTGGAGAGAGAAGGG - Intronic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
945205852 2:207331390-207331412 CATAGGGTGTGGAAGGAGAAAGG - Intergenic
946155687 2:217805166-217805188 CTGCGGGTGGGGGTGGGGAACGG - Intronic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946200854 2:218069936-218069958 CTGCGTGTGTGTGGGGAGCAGGG - Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946603386 2:221375168-221375190 CTGAGTGTGAGGAGGAAGAAAGG + Intergenic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
946772627 2:223104511-223104533 CTGCGGGTGGTGAGGGAGAGAGG + Intronic
947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG + Intronic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948368487 2:237473554-237473576 CTGCAGGCGGGGAGGGAGATGGG - Intergenic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948572880 2:238928289-238928311 CTGGGAATGTGGAGGGAGCAGGG + Intergenic
948860728 2:240751479-240751501 ATTAGGGTGTGGAGGGAGCAAGG - Intronic
1168852592 20:986807-986829 CCAAGTGTGTGGAGGGAGAATGG + Intronic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169122757 20:3107212-3107234 CTGCGAGTGAGGACAGAGAATGG + Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1170963818 20:21049045-21049067 CTGGGAGGGTGGAGGGAGAATGG + Intergenic
1171016561 20:21547413-21547435 CAGGGGCTGGGGAGGGAGAATGG + Intergenic
1171019459 20:21572084-21572106 TTGAGGGAGTGGAGAGAGAAGGG + Intergenic
1172015365 20:31869921-31869943 CTGGGGCTGGGGAGGCAGAAAGG + Intronic
1172083021 20:32357921-32357943 GTGCGGGTGGGGAGTGAGGATGG - Intergenic
1172617237 20:36297467-36297489 CTGAAGGTGTGGAGTGAGCAAGG - Intergenic
1173336440 20:42115849-42115871 TTGGGGGTCTGGAAGGAGAAAGG + Intronic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1173672755 20:44809906-44809928 GCGCGGGTGAGGAGGGAGATGGG + Intronic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174045596 20:47730355-47730377 ATTCAGGTGTGGAAGGAGAAAGG + Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1174743626 20:53040331-53040353 TGGCTGGTGTGGAGGGAGGAGGG + Intronic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175367834 20:58467659-58467681 CTGCAGGGGTGGAAGGAGATGGG + Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1177284567 21:19033097-19033119 CTGCAGGTGTCAAGGGAGTAGGG + Intergenic
1177539471 21:22472476-22472498 CCAAGGGTGGGGAGGGAGAAAGG + Intergenic
1178036511 21:28589397-28589419 CTGAGGGGGTTGGGGGAGAAAGG + Intergenic
1178329551 21:31675880-31675902 CTACGGGGGAGGTGGGAGAAAGG + Intronic
1178680487 21:34669486-34669508 CCGCGGGCGGGGAGGCAGAAGGG + Exonic
1179896110 21:44364638-44364660 CTCAGGGTGTGCTGGGAGAATGG + Intronic
1179980784 21:44894680-44894702 CTGCGGGTCTCTATGGAGAAGGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180189575 21:46155970-46155992 CTGGGGCTGTGGAGGGCGAGAGG + Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182060495 22:27393796-27393818 CTGCGGTTGTTCAGGGAGAAAGG + Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182371111 22:29811677-29811699 CTCAGGGTGAGGAGGAAGAAAGG - Intronic
1182827363 22:33277314-33277336 CAGCCGATGTGGAGGAAGAAGGG + Intronic
1183030766 22:35102839-35102861 TTGCAGAGGTGGAGGGAGAAGGG - Intergenic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1183398515 22:37587294-37587316 CAACTGGTGTGGAGGGAGAGGGG + Intergenic
1183520374 22:38293323-38293345 TTGAGGGTGGGGAGGGAGAGAGG + Intronic
1183585535 22:38751005-38751027 CTGCGGGTGCGGAGGAGGAGAGG - Exonic
1183665768 22:39244926-39244948 CTGCGGGTGCGCAGGGAGGCAGG + Intergenic
1184148722 22:42626529-42626551 TGGCTGGTGTGGAGGGAGAGAGG - Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
950379489 3:12599353-12599375 CTGCTGCTATGGAGGGAGCATGG - Intronic
950553641 3:13682423-13682445 GTGAGGGTGTAGAGGGAGCAGGG + Intergenic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
951088281 3:18540476-18540498 CTTGGGGTGGGAAGGGAGAAAGG + Intergenic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953044088 3:39280216-39280238 CTGCGGAGCTGGAGGGAGAGAGG + Intronic
953099692 3:39811771-39811793 CTGCGTGTATGGTGGTAGAAGGG + Intronic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953865780 3:46582029-46582051 CTGCGTGTGTGCAGGGAGACTGG + Exonic
953927838 3:46991383-46991405 CTGCAGGTGTGGACAGAGATGGG - Intronic
953982067 3:47417995-47418017 GTGCGGGGGTGGGGGGAGAGGGG + Intronic
954298318 3:49686252-49686274 CTGCGGGTGAGACGGGAGGAAGG - Intronic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954941388 3:54376192-54376214 CTGCAGGTGTGGAATGGGAAGGG - Intronic
955065304 3:55528878-55528900 CTGGGGGTGGGGAGGGATATGGG + Intronic
955350402 3:58189270-58189292 CTGGGGGTGGGGTGGGTGAAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959611653 3:108301723-108301745 CTGCTTGAGTTGAGGGAGAAAGG - Intronic
960266207 3:115624012-115624034 TTGAGGGTGTGGACGTAGAAAGG + Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
961863457 3:129936497-129936519 CTGCAGGGGGGAAGGGAGAATGG + Intergenic
962709872 3:138077330-138077352 CTGCCGCTGTGAAGTGAGAAAGG + Intronic
962807892 3:138939748-138939770 CAGCGGGTGGGGAGCGAGAGGGG - Intergenic
963542759 3:146615187-146615209 CTGAGGATGTGGAGAGAGATGGG - Intergenic
963987177 3:151609832-151609854 CTGCTGGTGGGGAGAGAGAGAGG + Intergenic
964042108 3:152273100-152273122 GTGCGTGTGTGGAGGGTGAGGGG + Intronic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
965637473 3:170798273-170798295 CTGGGGGTTGAGAGGGAGAAGGG + Intronic
966893593 3:184426107-184426129 CTGGGGGTGGGGTGGGAGTAGGG + Intronic
966917435 3:184592889-184592911 AGGCGGGTGTGGAAGGAGAAGGG - Intronic
969321758 4:6417000-6417022 AGGCAGGTGTGGAGGGAGCAGGG - Intronic
969392748 4:6901971-6901993 CAGCGGCTCTGGAGGGAGACAGG + Intergenic
969432335 4:7162709-7162731 CTTAGGGAGTGGAGGAAGAAGGG + Intergenic
969456622 4:7303873-7303895 CTGAGAGTGTGGGGAGAGAAAGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969593414 4:8134417-8134439 CTGTGGGTGTGGAGAGGGAGGGG - Intronic
969643554 4:8413175-8413197 GTGCAGGGGTGGAGGGAGATGGG - Intronic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
970405917 4:15764136-15764158 CTGTGCATGTGTAGGGAGAAGGG + Intergenic
970842275 4:20488474-20488496 ATGGGGGTGGGGTGGGAGAATGG - Intronic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974683554 4:65195259-65195281 CTGAGGGTGCTGAGGAAGAAGGG + Intergenic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
976300207 4:83509354-83509376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
976397692 4:84573957-84573979 CTGCTGATGTGGAGGAAGAGTGG - Intergenic
978010427 4:103675584-103675606 CTTCAGGTGTGAAGGGTGAAAGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
981547257 4:145906510-145906532 CTGAGGGTGTGGAGGGGGTTAGG - Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
983604082 4:169565793-169565815 CTGCGGGGTTGGGGGAAGAATGG + Intronic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985573237 5:661943-661965 CTGGAAGTGTGGAGGGAGAGTGG + Exonic
985997880 5:3606716-3606738 TGGCGGGGGTGGAGGGAGACCGG + Intergenic
986730127 5:10629163-10629185 CTGCTGGTGTGGAGAATGAATGG + Intronic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989306058 5:39957242-39957264 GTGGGGGTGGGGAGAGAGAAAGG + Intergenic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
992342720 5:75842377-75842399 CTGGGAGTGTGGAGAGATAAGGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
996008379 5:118451232-118451254 ATGGGGGTGGGGAGGAAGAATGG + Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999320852 5:150614282-150614304 CTGTGTGTGTGGTGGGGGAAGGG - Intronic
999519106 5:152332126-152332148 CTGCTTGTGTGGAGGGGGCAGGG + Intergenic
1000574457 5:162959711-162959733 AAGCGGGTCTGGAAGGAGAAAGG + Intergenic
1001093399 5:168758009-168758031 CTCCCGGTGTGGAAGGAAAATGG - Intronic
1001634927 5:173202998-173203020 CTGCTGGAGAGGAGGGAGAAGGG - Intergenic
1002382321 5:178839640-178839662 CTGGGGGTGTGCAGGGCTAATGG + Intergenic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1003081168 6:3023000-3023022 CTGGGGGCGTTGAGGAAGAAGGG - Intergenic
1003242783 6:4358952-4358974 CTGCGGTGGGGGAGAGAGAAGGG + Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004461338 6:15839788-15839810 CTGCTGGTGGGGAGGCAAAATGG - Intergenic
1005809620 6:29506056-29506078 CTGAGGGTGGGGATGAAGAAGGG - Intergenic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1005938877 6:30546156-30546178 ATGCGGATGAGGAGGGAGAAGGG - Exonic
1006118991 6:31792631-31792653 CTGCGGGAGAGGAGGGAGAGGGG - Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006667401 6:35705703-35705725 CTGGGGGTGAGGAGGGTGAGGGG + Intronic
1006781944 6:36637859-36637881 CTGCGGGTGCTGAGGGGGTAAGG - Intergenic
1006796386 6:36734984-36735006 CTCAGGCTGTGGAGTGAGAAGGG + Intergenic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007758486 6:44116827-44116849 CTGGGGTTGGAGAGGGAGAATGG + Intronic
1007975696 6:46098978-46099000 CTGCGGGGGTGGGGGTAGAAGGG + Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG + Intergenic
1012525320 6:100170202-100170224 CTGAAGGGGTGGAGGGGGAAGGG - Intergenic
1014520711 6:122439094-122439116 CTGCAGGTGTGGAGAGTGCAAGG + Intergenic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016292157 6:142537961-142537983 CTGAGGCTTTGAAGGGAGAAGGG - Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1017011196 6:150064855-150064877 CTGGGGGTAGGAAGGGAGAAGGG + Intronic
1018349070 6:162937366-162937388 GTGCAGGTGTAGAGAGAGAAGGG + Intronic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1018596614 6:165487860-165487882 CTGCAAGTGTGCAGGGAAAAGGG - Intronic
1018837803 6:167498330-167498352 GTGCAGGTGAGGAGGGGGAAGGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019587467 7:1813204-1813226 ATGCGGATGTGGACGGGGAAGGG + Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021411036 7:20330488-20330510 ATTCGGGGGAGGAGGGAGAAGGG + Intergenic
1021543598 7:21788563-21788585 CTGCTGGTGGGGAGAGAGGAAGG - Intronic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1022251029 7:28608579-28608601 GTGCTGGTGGGGAGGGAGATTGG - Intronic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1024843352 7:53613749-53613771 ATGGGGGTGTGGAGGGAGTGAGG + Intergenic
1026212730 7:68321204-68321226 CTGGAGGTGGTGAGGGAGAATGG - Intergenic
1026847782 7:73707318-73707340 CTCCCAGTGTGGAGGGAGAGGGG + Intronic
1028074504 7:86494905-86494927 CTGCAGGTGATGAGGAAGAATGG - Intergenic
1029400472 7:100342280-100342302 GTGGGGGAGGGGAGGGAGAATGG - Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029547183 7:101216678-101216700 GTGCGGGTGAGGAGAGGGAAAGG - Exonic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1031295491 7:119997376-119997398 CTGGTGGTGTGGTGGCAGAAAGG - Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1032474982 7:132205439-132205461 CTGCCCCAGTGGAGGGAGAAGGG + Intronic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1034432987 7:151050235-151050257 CTACCTGTGTGGAGGGACAATGG + Exonic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034507357 7:151504053-151504075 CTGCCAGTCTGGAGGGAGACAGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035436489 7:158863735-158863757 CTCCGGGTGTGTGGGGGGAAGGG + Intronic
1035762767 8:2081459-2081481 CTGCTCGTGAGGAGTGAGAAGGG - Intronic
1036007029 8:4676608-4676630 CTGCAGGTGCGAAAGGAGAATGG - Intronic
1036048797 8:5172969-5172991 ATGAGTGTCTGGAGGGAGAAGGG - Intergenic
1036672097 8:10797120-10797142 TTGCTGCCGTGGAGGGAGAAGGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037447453 8:18980656-18980678 GAGCGTGTGTGGAGGGAGAGAGG - Intronic
1037739976 8:21600999-21601021 CTGGAAGTGTGGAGGGTGAAGGG - Intergenic
1039435675 8:37557652-37557674 CTGCGGGAGATCAGGGAGAAGGG - Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1041292362 8:56319778-56319800 CTCCGGGTGGGGAGGGAGGCTGG + Intronic
1041724964 8:61009762-61009784 CTGCCGATGGGGTGGGAGAAAGG + Intergenic
1042976127 8:74471671-74471693 CTGGGGATGGGGATGGAGAAAGG - Intronic
1043635051 8:82375011-82375033 AAGCAGGTGTGGAGGGAGGAAGG + Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044441607 8:92230776-92230798 AGGGGGGTGTGGAGGGAGAGGGG + Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1045506512 8:102782411-102782433 CTGGGTGTGTGGAGGGACAGAGG + Intergenic
1045820550 8:106332047-106332069 CTGAGGATGGGGAGGAAGAAGGG - Intronic
1045866210 8:106868493-106868515 CTGCATGTGTGCAGGGAGAAGGG - Intergenic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1047175466 8:122536519-122536541 CTCTGGGTGGGGTGGGAGAATGG + Intergenic
1047210332 8:122835354-122835376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
1047211074 8:122840975-122840997 TTCCGGGTGTGGAGGATGAACGG - Intronic
1047214059 8:122862763-122862785 CTGGGCGTGGGGAGTGAGAACGG + Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048460107 8:134614473-134614495 CTGTGTGTGTGTAAGGAGAATGG - Intronic
1048583461 8:135750204-135750226 CTGCTGGTGTGGGGGAAGCAGGG + Intergenic
1048717148 8:137282805-137282827 CTGAGGGTTTGAAGGGGGAAGGG - Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049332166 8:142060335-142060357 CTGCGGTGGTGGAGGCAAAATGG + Intergenic
1049374425 8:142282202-142282224 CTGGGGGGGTGTAGGGAGAGCGG - Intronic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049726730 8:144150011-144150033 CTGGGTGTGTGCAGGGAGACTGG - Intronic
1049803252 8:144527780-144527802 CTGCGGGTCTGGGGGATGAAGGG + Exonic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050808997 9:9719665-9719687 CTGCGGCGGTGAGGGGAGAAGGG + Intronic
1050878042 9:10666018-10666040 ATGCAGGTGTGGAGAGAGACAGG + Intergenic
1051506224 9:17830538-17830560 CTGAGATTTTGGAGGGAGAAAGG - Intergenic
1053001271 9:34578380-34578402 CTGGGGGAGGGGAGGCAGAAGGG + Intronic
1053177703 9:35940588-35940610 GTGCAGGTGTGGGAGGAGAAAGG - Intergenic
1053289143 9:36868539-36868561 GTGAGGATGGGGAGGGAGAAAGG + Intronic
1055757302 9:79570900-79570922 CTCCGGGGGTGGAGGGAGGGAGG + Intergenic
1055828940 9:80358320-80358342 CTGCAGGTGGGGAGGTAGCAGGG + Intergenic
1056664579 9:88571581-88571603 CTGCGCGTGTGGAGTGGGCAGGG + Intronic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057208747 9:93188161-93188183 CTGCGGGAGTAGGGGAAGAAAGG - Intronic
1058618424 9:106860458-106860480 CAGGCGGTGGGGAGGGAGAAAGG - Intergenic
1058690296 9:107514675-107514697 CTGCGGATGTGGAGGGCCAGAGG + Intergenic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059706740 9:116830964-116830986 CTGTGGGTGGGTGGGGAGAAGGG - Intronic
1060214835 9:121732499-121732521 TGGCTGGTCTGGAGGGAGAAGGG + Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1061717534 9:132529892-132529914 CTGCTGGTGAGGATGGAAAATGG - Intronic
1061727010 9:132587563-132587585 CTGCGGGGGTAGAGGCAGAAAGG + Intronic
1062078090 9:134603051-134603073 CTGCTGGTGTGGTGCGAGGATGG + Intergenic
1062177796 9:135173847-135173869 CTGCGGGCTGTGAGGGAGAAGGG + Intergenic
1062391670 9:136336358-136336380 CTGGGGGTGTGGAGGGATTCGGG - Intronic
1062601687 9:137321187-137321209 CTGAGGCTGTGGGGGCAGAAGGG + Intronic
1062667533 9:137683867-137683889 CTGCGGGGGTGGAGAGTGAGGGG - Intronic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1187461073 X:19487122-19487144 CTGGGGGTGGGGGGGGGGAAGGG + Intronic
1188515144 X:30977402-30977424 CTGAGAGTGAGGAGGCAGAAAGG - Intergenic
1188945019 X:36290019-36290041 GAGAGGGTGTGGAGGGAGAATGG - Intronic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189075054 X:37905950-37905972 CTGGGGGTGGGGAGGGAGAGGGG + Intronic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189277521 X:39797546-39797568 CTGCAGGTCTGGCTGGAGAAAGG + Intergenic
1189537119 X:41946880-41946902 CTGAGGGTTGTGAGGGAGAAAGG + Intergenic
1190333913 X:49251422-49251444 GTGCGGGTGGAGAGCGAGAAGGG - Exonic
1190741072 X:53289158-53289180 ATGTGTGTGTGGAGGGGGAAGGG - Intronic
1192366801 X:70480508-70480530 CTCCCGCTGTGAAGGGAGAATGG + Intronic
1192860937 X:75069683-75069705 GTGGGGTTGGGGAGGGAGAAGGG + Intronic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194765170 X:97841540-97841562 GGGCGGGGGTGGGGGGAGAAGGG - Intergenic
1195068525 X:101258541-101258563 CTGCAGGTGAGGATGGAGACAGG + Exonic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1195975573 X:110522477-110522499 CTGCGTGTGTGCAGGGAGACTGG + Intergenic
1196950265 X:120869850-120869872 CTGCGGCTGGGAAGGGAGACAGG - Intergenic
1197441766 X:126500201-126500223 TTGCTGGTGTGAAGGGAAAATGG - Intergenic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1198433122 X:136587820-136587842 CTACAGGTGTTGGGGGAGAAGGG + Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1201595150 Y:15660016-15660038 CTGGGAGTGTGGTGGGAGTAGGG - Intergenic