ID: 1166154252

View in Genome Browser
Species Human (GRCh38)
Location 19:40899041-40899063
Sequence CTGTATGAACACAAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166154250_1166154252 -10 Left 1166154250 19:40899028-40899050 CCTAGTTTGCAGGCTGTATGAAC No data
Right 1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG No data
1166154245_1166154252 18 Left 1166154245 19:40899000-40899022 CCCAACCATTTTAAAATGCCAAA No data
Right 1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG No data
1166154247_1166154252 13 Left 1166154247 19:40899005-40899027 CCATTTTAAAATGCCAAAAGCAT No data
Right 1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG No data
1166154246_1166154252 17 Left 1166154246 19:40899001-40899023 CCAACCATTTTAAAATGCCAAAA No data
Right 1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG No data
1166154248_1166154252 0 Left 1166154248 19:40899018-40899040 CCAAAAGCATCCTAGTTTGCAGG No data
Right 1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG No data
1166154244_1166154252 19 Left 1166154244 19:40898999-40899021 CCCCAACCATTTTAAAATGCCAA No data
Right 1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166154252 Original CRISPR CTGTATGAACACAAGCAGCA GGG Intergenic
No off target data available for this crispr