ID: 1166157334

View in Genome Browser
Species Human (GRCh38)
Location 19:40923703-40923725
Sequence GCATTTACATTTGTGTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166157334_1166157335 9 Left 1166157334 19:40923703-40923725 CCACAACACACAAATGTAAATGC No data
Right 1166157335 19:40923735-40923757 TATGAAACTGTATAAATACAAGG No data
1166157334_1166157336 28 Left 1166157334 19:40923703-40923725 CCACAACACACAAATGTAAATGC No data
Right 1166157336 19:40923754-40923776 AAGGAAGCTCCACACGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166157334 Original CRISPR GCATTTACATTTGTGTGTTG TGG (reversed) Intergenic
No off target data available for this crispr