ID: 1166157391

View in Genome Browser
Species Human (GRCh38)
Location 19:40924254-40924276
Sequence GGGCAGTCAGACTGGAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166157385_1166157391 4 Left 1166157385 19:40924227-40924249 CCCAGTTAGAGGCTGCAGTGGGG 0: 1
1: 0
2: 3
3: 74
4: 406
Right 1166157391 19:40924254-40924276 GGGCAGTCAGACTGGAACCATGG 0: 1
1: 0
2: 0
3: 10
4: 208
1166157387_1166157391 3 Left 1166157387 19:40924228-40924250 CCAGTTAGAGGCTGCAGTGGGGT 0: 1
1: 0
2: 0
3: 60
4: 271
Right 1166157391 19:40924254-40924276 GGGCAGTCAGACTGGAACCATGG 0: 1
1: 0
2: 0
3: 10
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166157391 Original CRISPR GGGCAGTCAGACTGGAACCA TGG Intergenic