ID: 1166161218

View in Genome Browser
Species Human (GRCh38)
Location 19:40954874-40954896
Sequence CTGTGGATAAGTAGTGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166161216_1166161218 2 Left 1166161216 19:40954849-40954871 CCTGAATATGTTTTCACTTCAAG No data
Right 1166161218 19:40954874-40954896 CTGTGGATAAGTAGTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166161218 Original CRISPR CTGTGGATAAGTAGTGTGCT TGG Intergenic
No off target data available for this crispr