ID: 1166165016 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:40981315-40981337 |
| Sequence | AGGTGGTTTCAGATGGAGAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1166165016_1166165023 | 18 | Left | 1166165016 | 19:40981315-40981337 | CCCTTCTCCATCTGAAACCACCT | No data | ||
| Right | 1166165023 | 19:40981356-40981378 | TCATATCACTATCAACATTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1166165016 | Original CRISPR | AGGTGGTTTCAGATGGAGAA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||