ID: 1166165016

View in Genome Browser
Species Human (GRCh38)
Location 19:40981315-40981337
Sequence AGGTGGTTTCAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165016_1166165023 18 Left 1166165016 19:40981315-40981337 CCCTTCTCCATCTGAAACCACCT No data
Right 1166165023 19:40981356-40981378 TCATATCACTATCAACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165016 Original CRISPR AGGTGGTTTCAGATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr