ID: 1166165645

View in Genome Browser
Species Human (GRCh38)
Location 19:40986520-40986542
Sequence GCTGCTCCCAATCAGGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165645_1166165653 10 Left 1166165645 19:40986520-40986542 CCTTTAGCCTGATTGGGAGCAGC No data
Right 1166165653 19:40986553-40986575 TTGCTGGGTCAGGAGTGCAGCGG No data
1166165645_1166165654 22 Left 1166165645 19:40986520-40986542 CCTTTAGCCTGATTGGGAGCAGC No data
Right 1166165654 19:40986565-40986587 GAGTGCAGCGGACACCATGCTGG No data
1166165645_1166165655 28 Left 1166165645 19:40986520-40986542 CCTTTAGCCTGATTGGGAGCAGC No data
Right 1166165655 19:40986571-40986593 AGCGGACACCATGCTGGATCTGG No data
1166165645_1166165649 -6 Left 1166165645 19:40986520-40986542 CCTTTAGCCTGATTGGGAGCAGC No data
Right 1166165649 19:40986537-40986559 AGCAGCAATGGGTGCCTTGCTGG No data
1166165645_1166165651 0 Left 1166165645 19:40986520-40986542 CCTTTAGCCTGATTGGGAGCAGC No data
Right 1166165651 19:40986543-40986565 AATGGGTGCCTTGCTGGGTCAGG No data
1166165645_1166165650 -5 Left 1166165645 19:40986520-40986542 CCTTTAGCCTGATTGGGAGCAGC No data
Right 1166165650 19:40986538-40986560 GCAGCAATGGGTGCCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165645 Original CRISPR GCTGCTCCCAATCAGGCTAA AGG (reversed) Intergenic