ID: 1166165648

View in Genome Browser
Species Human (GRCh38)
Location 19:40986527-40986549
Sequence ACCCATTGCTGCTCCCAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165648_1166165660 29 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165660 19:40986579-40986601 CCATGCTGGATCTGGAGGGGTGG No data
1166165648_1166165653 3 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165653 19:40986553-40986575 TTGCTGGGTCAGGAGTGCAGCGG No data
1166165648_1166165658 26 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165658 19:40986576-40986598 ACACCATGCTGGATCTGGAGGGG No data
1166165648_1166165654 15 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165654 19:40986565-40986587 GAGTGCAGCGGACACCATGCTGG No data
1166165648_1166165651 -7 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165651 19:40986543-40986565 AATGGGTGCCTTGCTGGGTCAGG No data
1166165648_1166165656 24 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165656 19:40986574-40986596 GGACACCATGCTGGATCTGGAGG No data
1166165648_1166165655 21 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165655 19:40986571-40986593 AGCGGACACCATGCTGGATCTGG No data
1166165648_1166165657 25 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165657 19:40986575-40986597 GACACCATGCTGGATCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165648 Original CRISPR ACCCATTGCTGCTCCCAATC AGG (reversed) Intergenic