ID: 1166165652

View in Genome Browser
Species Human (GRCh38)
Location 19:40986551-40986573
Sequence GCTGCACTCCTGACCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165652_1166165658 2 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165658 19:40986576-40986598 ACACCATGCTGGATCTGGAGGGG No data
1166165652_1166165661 15 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165661 19:40986589-40986611 TCTGGAGGGGTGGAAGTCAGTGG No data
1166165652_1166165662 23 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165662 19:40986597-40986619 GGTGGAAGTCAGTGGCACATCGG No data
1166165652_1166165654 -9 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165654 19:40986565-40986587 GAGTGCAGCGGACACCATGCTGG No data
1166165652_1166165664 30 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165664 19:40986604-40986626 GTCAGTGGCACATCGGCAGGCGG No data
1166165652_1166165655 -3 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165655 19:40986571-40986593 AGCGGACACCATGCTGGATCTGG No data
1166165652_1166165663 27 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165663 19:40986601-40986623 GAAGTCAGTGGCACATCGGCAGG No data
1166165652_1166165657 1 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165657 19:40986575-40986597 GACACCATGCTGGATCTGGAGGG No data
1166165652_1166165660 5 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165660 19:40986579-40986601 CCATGCTGGATCTGGAGGGGTGG No data
1166165652_1166165656 0 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165656 19:40986574-40986596 GGACACCATGCTGGATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165652 Original CRISPR GCTGCACTCCTGACCCAGCA AGG (reversed) Intergenic