ID: 1166165654

View in Genome Browser
Species Human (GRCh38)
Location 19:40986565-40986587
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165648_1166165654 15 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165654 19:40986565-40986587 GAGTGCAGCGGACACCATGCTGG No data
1166165652_1166165654 -9 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165654 19:40986565-40986587 GAGTGCAGCGGACACCATGCTGG No data
1166165645_1166165654 22 Left 1166165645 19:40986520-40986542 CCTTTAGCCTGATTGGGAGCAGC No data
Right 1166165654 19:40986565-40986587 GAGTGCAGCGGACACCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165654 Original CRISPR GAGTGCAGCGGACACCATGC TGG Intergenic