ID: 1166165656

View in Genome Browser
Species Human (GRCh38)
Location 19:40986574-40986596
Sequence GGACACCATGCTGGATCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165652_1166165656 0 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165656 19:40986574-40986596 GGACACCATGCTGGATCTGGAGG No data
1166165648_1166165656 24 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165656 19:40986574-40986596 GGACACCATGCTGGATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165656 Original CRISPR GGACACCATGCTGGATCTGG AGG Intergenic
No off target data available for this crispr