ID: 1166165660

View in Genome Browser
Species Human (GRCh38)
Location 19:40986579-40986601
Sequence CCATGCTGGATCTGGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165652_1166165660 5 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165660 19:40986579-40986601 CCATGCTGGATCTGGAGGGGTGG No data
1166165648_1166165660 29 Left 1166165648 19:40986527-40986549 CCTGATTGGGAGCAGCAATGGGT No data
Right 1166165660 19:40986579-40986601 CCATGCTGGATCTGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165660 Original CRISPR CCATGCTGGATCTGGAGGGG TGG Intergenic
No off target data available for this crispr