ID: 1166165661

View in Genome Browser
Species Human (GRCh38)
Location 19:40986589-40986611
Sequence TCTGGAGGGGTGGAAGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 802
Summary {0: 18, 1: 83, 2: 109, 3: 126, 4: 466}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165652_1166165661 15 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165661 19:40986589-40986611 TCTGGAGGGGTGGAAGTCAGTGG 0: 18
1: 83
2: 109
3: 126
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165661 Original CRISPR TCTGGAGGGGTGGAAGTCAG TGG Intergenic
900690521 1:3977860-3977882 GTTGGAGGGGTGGGAGTCGGCGG + Intergenic
900925765 1:5705332-5705354 CCTGGAGGGGAGGAATACAGGGG - Intergenic
900959675 1:5910861-5910883 TGTGGATGGGTGGAAGGCATTGG + Intronic
900978559 1:6033127-6033149 TATTGAGGGGTGGAGCTCAGGGG + Intronic
901625444 1:10622110-10622132 TGTGGAGGGGTGGAGGTGGGTGG - Intronic
901849587 1:12007046-12007068 TCTGCAGGTGTGGAAGGCAGTGG + Exonic
903022411 1:20403596-20403618 TCTGGGGGGATGGATGTCACAGG - Intergenic
904131949 1:28281830-28281852 TCTGCAGCTGTGGCAGTCAGAGG - Exonic
905393190 1:37651125-37651147 TCTGCGGGGGTGGCAATCAGTGG - Intergenic
905649489 1:39646861-39646883 TCTGGAGGCGTGGCAGCCTGGGG + Intergenic
905664652 1:39755698-39755720 TCTGGGGAGGTGGAGGCCAGTGG + Intronic
906038071 1:42765629-42765651 TGTGGAGGGGTGGAAATCTGAGG + Intronic
906507524 1:46391148-46391170 TCCAGAGGGATGGAAGTCGGCGG + Intergenic
906582994 1:46952042-46952064 TCTGGAGGGATGGAAGTCAGTGG - Intergenic
906922366 1:50078294-50078316 TATGGAGTGGGGGAAGTGAGTGG + Intronic
907275514 1:53314705-53314727 CCTAGTGGGGTGGAGGTCAGGGG - Intronic
907463740 1:54621694-54621716 GCTGGAGGGCTGGAGGGCAGAGG + Intronic
907504955 1:54911335-54911357 TTTGGAGGGATGAAAGTCAGTGG + Intergenic
907844488 1:58191450-58191472 TCTGGTGTGCTGGAATTCAGTGG - Intronic
907886023 1:58593028-58593050 CAAAGAGGGGTGGAAGTCAGAGG - Intergenic
908717666 1:67087554-67087576 TCTGGAGGGGTGGAAATCAACGG - Intergenic
908723221 1:67148191-67148213 TCCAGAGGGGTGGAAGTCAGTGG + Intronic
908892686 1:68863882-68863904 TCCAGAGGGGTGGAAGTCAGTGG - Intergenic
910059676 1:83074606-83074628 TCTGAATTGGTGTAAGTCAGAGG + Intergenic
910091442 1:83469276-83469298 GCTGGAGGAATGGATGTCAGTGG + Intergenic
910117554 1:83749124-83749146 TCTGGAGGCTTGGAAGTCCAAGG + Intergenic
910219413 1:84875529-84875551 GGTGGAGGGGTGGAAGGGAGAGG - Intronic
910718428 1:90257915-90257937 TCTGGAAGATAGGAAGTCAGTGG + Intergenic
912274370 1:108240877-108240899 TGTGGAGGTGTGGAGGTCTGGGG + Intronic
912285714 1:108366255-108366277 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
912286897 1:108378985-108379007 TGTGGAGGTGTGGAGGTCTGGGG - Intronic
912293849 1:108453446-108453468 TGTGGAGGTGTGGAGGTCTGGGG - Intronic
912463399 1:109852559-109852581 TCCAGAGGGGCGGAAGTCAGTGG + Intergenic
912691904 1:111810969-111810991 GCTGGAGGGGTGACAGGCAGAGG - Intronic
912788406 1:112626491-112626513 ACTGGGTGGGTGGAAGACAGGGG - Intronic
913166530 1:116192223-116192245 TGTGGAGTGGTGAAAGTCAGGGG + Intergenic
914323812 1:146591598-146591620 ACTGGAGGGATGGGAGTGAGTGG - Intergenic
915040915 1:152967602-152967624 TCTGGAGGGGTTGATTTGAGGGG + Intergenic
915895567 1:159808748-159808770 TCTGGAATCTTGGAAGTCAGAGG - Intronic
915920714 1:159973472-159973494 TCTGGAATCTTGGAAGTCAGAGG + Intergenic
916258868 1:162820264-162820286 TTTGCAGGGATGGAAGACAGAGG - Intergenic
916281550 1:163057158-163057180 TCTGGAGGGAAGGAAGGCAAGGG - Intergenic
917097527 1:171414038-171414060 TCCCAAGGGGTGGAAGTCAACGG + Intergenic
917413370 1:174783105-174783127 TCCAGAGGGCTGGAAGTCAACGG - Intronic
918372580 1:183876035-183876057 TCTTGAGGGTTAGGAGTCAGTGG - Intronic
918885735 1:190191401-190191423 TGTTGAGGGGTGGAGGTGAGGGG - Intronic
919082775 1:192886760-192886782 TCTGGAGGTATGGGAGTCAGCGG + Intergenic
920639847 1:207741481-207741503 TCCGGAGGAATGGAAGTCAGCGG + Intergenic
921076834 1:211706711-211706733 TCTGCAGGCTGGGAAGTCAGAGG + Intergenic
921229288 1:213051733-213051755 TCTGGGGGTGGGGCAGTCAGTGG + Intronic
921624386 1:217362287-217362309 CCAGAAGGGGTGGAAGTGAGTGG - Intergenic
922007933 1:221551018-221551040 TCTGGAGGGATGGAAGTCAGTGG + Intergenic
922685154 1:227633125-227633147 TCCGGAGGGGTGGAAGTCATTGG + Intronic
922876310 1:228942549-228942571 TCTGGAGGCATGGAAGTCAGCGG - Intergenic
922877774 1:228953927-228953949 TCCAGAGGGATGGAAGTTAGTGG - Intergenic
923017254 1:230136519-230136541 TCTGGATGGGGGGCAGTGAGGGG - Intronic
923209119 1:231787288-231787310 TCTGGAGGCTTGGAAGTCCAAGG + Intronic
923230363 1:231980816-231980838 TTTTGAGGGGTGGAAGTGTGAGG + Intronic
924247550 1:242099545-242099567 TCTGCAGGGGCGGGAGGCAGTGG + Intronic
1062830553 10:602617-602639 TCTGGAGGCTGGGAAGTCCGAGG - Intronic
1063377849 10:5564749-5564771 GCAGGCGGGGAGGAAGTCAGAGG - Intergenic
1063434042 10:6016307-6016329 TCTGGAGGCTGGGAAGTCTGAGG - Intronic
1063561695 10:7134153-7134175 TCTGGAGGGTGGGAAGTCCAAGG - Intergenic
1065194998 10:23255881-23255903 TCTGGAAGGGTGGTAATGAGAGG + Intergenic
1065199854 10:23301975-23301997 TCCAGAGGGATGGAAGTCAGCGG + Intronic
1066246832 10:33591927-33591949 TCCAGAGGGATGGAAGTCAGTGG + Intergenic
1066441638 10:35445124-35445146 ACTGTAGGTCTGGAAGTCAGTGG + Intronic
1066641693 10:37560500-37560522 TCTGGAGGTCTGGGAGTTAGAGG - Intergenic
1066673011 10:37859420-37859442 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1068037932 10:51784141-51784163 TGTGGAGATGGGGAAGTCAGGGG - Intronic
1068120269 10:52777458-52777480 ACTGGAGAGATGGAAGTCAGGGG + Intergenic
1068191618 10:53659789-53659811 TCCGGAGGGATGGAAGTCAGTGG - Intergenic
1068522101 10:58088087-58088109 TCAGGAGTGGAGGAAGTGAGAGG + Intergenic
1068791291 10:61034015-61034037 TCCGGAGGGGTGGAAGTCAGTGG + Intergenic
1068792066 10:61039480-61039502 TCCGGAGGGGTGGAAGTCAGTGG + Intergenic
1068988843 10:63130978-63131000 TCCAGAGGGGTGGAAGTCAGCGG + Intergenic
1069037960 10:63664963-63664985 TCCAGAGGGGTGGAAGTCAGTGG + Intergenic
1069261553 10:66404271-66404293 TCTGAAGGCTTGGAAGTTAGGGG - Intronic
1070331083 10:75417733-75417755 TCTTGAGGGGTGGAAATGACTGG + Intergenic
1070569436 10:77630185-77630207 TCTGGAGTGTTTGAAGTCAGTGG - Intronic
1071051879 10:81460198-81460220 TCCAGAGGGATGGAAGTCAGTGG - Intergenic
1071082699 10:81831275-81831297 TCCAGAGGGGCGGAAGTCAGCGG + Intergenic
1071326721 10:84525697-84525719 TCCGGAGGGGTGGAAGTCAGCGG + Intergenic
1071327410 10:84530637-84530659 TCCAGAGGGGTGGAAGTCAGCGG + Intergenic
1071331535 10:84565533-84565555 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
1074450341 10:113554248-113554270 TCGGGAGGGGTGGTAGAAAGTGG + Intronic
1074735557 10:116428580-116428602 TCTGGAGGGCTGTTAGTCTGTGG + Intronic
1074978460 10:118599852-118599874 TCCAGAGGGGTGGAAGTCAGAGG + Intergenic
1076104433 10:127809437-127809459 TCTGGAGGCTGGGAAGTCCGAGG - Intergenic
1076295559 10:129381093-129381115 TCTGGAGGCCTGGAAGTCCAAGG - Intergenic
1076550971 10:131278004-131278026 TCTGGAGGGAGGAAAGTCTGAGG + Intronic
1076857870 10:133126511-133126533 TCCGTAGGGGTGGCAGCCAGGGG + Intronic
1077212516 11:1378421-1378443 GCTGGAGGGTTGGAGGGCAGTGG - Intergenic
1078043806 11:7894205-7894227 CCTGGAGGGGTGGCAGGGAGAGG - Intergenic
1078191865 11:9097725-9097747 TCTGGAGGGGTGGAAGTCAGCGG - Intronic
1079533441 11:21482687-21482709 TCTCCAGTGGTGGAACTCAGTGG + Intronic
1079601739 11:22317904-22317926 TCCGGAGGGATGGAAGTCAGTGG + Intergenic
1079761856 11:24338964-24338986 TCCAGAGGTGTGGAAGTCAGCGG - Intergenic
1079884280 11:25966524-25966546 TCCTGAGGGATGGAAGTCAGTGG + Intergenic
1079933251 11:26590778-26590800 TCCGGAGGGGTGGAAGTCAGTGG + Intronic
1079934237 11:26597497-26597519 TCTGGAGGGGTTGAAGTCAGCGG + Intronic
1080881479 11:36325324-36325346 TCTGGAGGGTTGGAAGTCAGCGG + Intronic
1081063038 11:38504033-38504055 TCCAGAGGGGTGGAAGTCAGCGG - Intergenic
1081070182 11:38602009-38602031 TCCAAAGGGGTGGAAGTCAATGG - Intergenic
1081831662 11:46120542-46120564 TGGGGAGGGGTGGAGGGCAGAGG + Intronic
1082737609 11:56873937-56873959 TCTGGAGGGGTGGAAGTCAGTGG - Intergenic
1083107006 11:60368077-60368099 TCCGGAGGGGTAGAAGTCAGCGG - Intronic
1083306714 11:61765444-61765466 CCTGGAGGGGTGCCAGGCAGTGG + Intronic
1083637144 11:64126838-64126860 TCTGGAGGTGAGGAAGGCTGGGG - Intronic
1083782625 11:64925991-64926013 TGGGGAGGGGTGGGAGGCAGCGG + Intronic
1084422382 11:69066800-69066822 TCTGGAGGCTTGGTAGGCAGAGG + Intronic
1084696433 11:70758376-70758398 TCCGGAGGGGTGGAAGTCAACGG - Intronic
1084878729 11:72154337-72154359 TCTGGAGGGGTGGAAGTCAGCGG - Intergenic
1084888013 11:72223404-72223426 GCTGGAGGGGAGGAAGCTAGGGG + Intergenic
1085272884 11:75280799-75280821 TCTGGAGGGGATGAAATGAGAGG + Intronic
1085529093 11:77181221-77181243 TCCAGAGGTGGGGAAGTCAGAGG + Intronic
1085621573 11:78041722-78041744 TCCGGAGGGATGGGAGTCAGTGG - Intronic
1087356361 11:97098695-97098717 TATGGAGGAGTGGAAGTGAAAGG + Intergenic
1087901297 11:103644855-103644877 TCTGGAGGGGTGGAAGTCAATGG + Intergenic
1088242930 11:107789666-107789688 TCCGGAGGGGTGGAAGTCAATGG - Intergenic
1088484619 11:110328709-110328731 TCCAGAGTGGTGGAAGTCAGTGG + Intergenic
1088772761 11:113052450-113052472 TCTAGAGGGGTGGAGGTGCGGGG - Intronic
1088879806 11:113964523-113964545 TCCAGAAGGATGGAAGTCAGCGG - Intergenic
1089565457 11:119368897-119368919 GCTGGAGGGGTGGAGCTGAGGGG + Intronic
1090419000 11:126561174-126561196 TCTGGAGAGCTGGAAGGCAGAGG - Intronic
1090664589 11:128906041-128906063 GCTGGAGGGGTGGGGGTGAGGGG - Intronic
1091647105 12:2282190-2282212 TCTGGAGGGAGGGAACACAGGGG + Intronic
1092228008 12:6761240-6761262 GCTGGAGTGCTGGAATTCAGTGG - Intronic
1092263468 12:6964248-6964270 TCCAGAGGGGTGAAGGTCAGAGG - Intergenic
1092373170 12:7933902-7933924 CCTGGAGGGAGGGAAGACAGAGG + Exonic
1092469919 12:8768290-8768312 TCTGGAGGGGTGGAAGTCAACGG + Intronic
1092895265 12:13004254-13004276 TGGGTAGGGGTGGGAGTCAGGGG - Intergenic
1092961157 12:13598024-13598046 TAGGGTGGGGTGGAAGGCAGTGG + Intronic
1093106658 12:15095424-15095446 TCCAGAGGGATGGAAGTCAGTGG + Intergenic
1093647792 12:21608399-21608421 CCTGGAGGGGATGAGGTCAGAGG + Intergenic
1094641001 12:32275695-32275717 TCTGGAGGGATGGGAGTCAGCGG - Intronic
1095138579 12:38636657-38636679 TCCGGAGGGGTGGGAGTGAATGG - Intergenic
1095893108 12:47253025-47253047 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
1095968528 12:47885232-47885254 CCTGGAGGGATGGAAGCCAGGGG - Intronic
1096036264 12:48473763-48473785 TCAGGTTGGGTGGAAGTCCGCGG + Intergenic
1096669515 12:53190245-53190267 TCTGCAGCGGTGTGAGTCAGTGG - Exonic
1097249039 12:57622321-57622343 CCTGGAGCCGTGGAAGTAAGAGG - Intronic
1097289010 12:57898206-57898228 TCCAGTGGGCTGGAAGTCAGAGG + Intergenic
1097376741 12:58852191-58852213 TCTGGAGGGATGGAAGTCAATGG + Intergenic
1097377749 12:58859320-58859342 TCTGGAGGGATGGAAGTCAACGG + Intergenic
1097840850 12:64319995-64320017 TCCGGAGGGATGGAAGTCAGTGG - Intronic
1098639874 12:72825600-72825622 TTGGGAGGGATGGAAGTCAGTGG + Intergenic
1098896734 12:76071275-76071297 CCTGGGAGGGTGGAAGTCAGAGG - Intronic
1098984877 12:77001485-77001507 TCCGGAGGGGTGGAAGTCAGCGG - Intergenic
1099292620 12:80790110-80790132 TCCAGAGGGATGGAAGTCAGTGG - Intergenic
1099798627 12:87429611-87429633 TCCAGAGGGGTGGAAGTCAGTGG + Intergenic
1099840688 12:87961880-87961902 ACTGGAGGGTTGGAAGACTGGGG - Intergenic
1101555291 12:105803011-105803033 TCTAGAGGGGTGGAAGTCAGCGG + Intergenic
1101558442 12:105832639-105832661 TCTTGAGAGGTAGAAGTTAGGGG - Intergenic
1102846376 12:116188731-116188753 TTAGGAGGGGTGGAAGTGGGAGG - Intronic
1102852013 12:116256422-116256444 CCTGGAGGGGAGGAAGGCTGAGG + Intronic
1103630449 12:122255772-122255794 TCTGGGGCAGTAGAAGTCAGTGG - Intronic
1103804001 12:123558415-123558437 TCCGGACGGCTAGAAGTCAGCGG - Intergenic
1103872337 12:124100805-124100827 TCCGGAGGGGTGGAAGTTAGTGG + Intronic
1103930733 12:124449527-124449549 TCTGGAGAGACGGAGGTCAGAGG - Intronic
1104063978 12:125291259-125291281 TCTGGAGGGTTGAAAGTCTAAGG - Intronic
1104187863 12:126449637-126449659 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
1104850963 12:131873527-131873549 TCCAGAGGGGTGGAAGTCAGCGG + Intergenic
1104859892 12:131918410-131918432 CCTGGAGGTGTGGGAGTCTGTGG + Intronic
1107700915 13:43046814-43046836 TCCAGAGGGGTGTAAGTCAGCGG - Intronic
1107758618 13:43652195-43652217 GGTGGAGGGGTGGAAGTCACCGG + Intronic
1107991112 13:45819907-45819929 TCTGGAGGCTGGGAAGTCAGCGG + Intronic
1108486349 13:50930150-50930172 TCTGGGGTGGGGGCAGTCAGTGG + Intronic
1108876205 13:55054058-55054080 TCTGGAGGGATGGGAGTCAGTGG - Intergenic
1108877225 13:55061373-55061395 TCTGGAGGGATGGGAGTCAGTGG - Intergenic
1109091057 13:58046551-58046573 TGTGGAGGGGTGGAAATTAATGG + Intergenic
1109292827 13:60497130-60497152 TCCGGAAGGGTGGAAGTCAACGG + Intronic
1109520627 13:63505549-63505571 TCCAGAGGGATGGAAGTCAGAGG + Intergenic
1109523583 13:63545109-63545131 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
1109594005 13:64525858-64525880 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
1109669115 13:65582248-65582270 TCTGGTGAGGGGGAAGTGAGAGG - Intergenic
1109680712 13:65748435-65748457 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1110496473 13:76174008-76174030 TCTGGGGGGCTGGAGGACAGTGG + Intergenic
1110846147 13:80192465-80192487 TCCGGAGGGATGGAAGTCAGCGG - Intergenic
1110987073 13:81984407-81984429 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
1111021446 13:82457718-82457740 TCCGGAGGGATGGGAGTCAGTGG - Intergenic
1111074681 13:83218056-83218078 TCTGGAGGGCTGGAAGTCCAAGG - Intergenic
1113143854 13:107185210-107185232 TCTGGAGGGCTAGAAGCCTGAGG - Intronic
1113592272 13:111509333-111509355 TCCAGAGGGATGGAAGTTAGAGG + Intergenic
1114384828 14:22243816-22243838 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
1114498994 14:23154310-23154332 GCTGGAGGGGAGGGAGTCTGTGG - Intronic
1114795419 14:25710077-25710099 TCTGGAGGCTTGGAAGTCCAAGG + Intergenic
1114840844 14:26260618-26260640 TCTGGAGGGATGGAAGTCAGTGG - Intergenic
1115757572 14:36544484-36544506 TCCGGAGGGATAGAAGTCAGCGG + Intergenic
1116118802 14:40694719-40694741 TCCGGAGGGATGGGAGTCAGCGG + Intergenic
1116740331 14:48746736-48746758 TCTGGAGGGATGGGAGTTAGCGG - Intergenic
1117171814 14:53108161-53108183 TCCGGAGGGATGGAAGTCAGCGG - Intronic
1117501102 14:56352185-56352207 ACTGGAGTAGTGCAAGTCAGGGG - Intergenic
1117852434 14:59989678-59989700 TGTGGAGAGGGGGAAGACAGAGG - Intronic
1117875623 14:60248586-60248608 TCTGGAGGAGTGGGACTCTGGGG + Intronic
1118453513 14:65925220-65925242 TCCGGAGGGTTGGGAGTCAGCGG + Intergenic
1118979152 14:70701959-70701981 CCTGGAGGGGTGGATGGCTGAGG - Intergenic
1119089938 14:71772180-71772202 TCTGGAGGGATGGAAGTCAGAGG + Intergenic
1119266965 14:73268496-73268518 TCTGGAGGTCTGGGAGACAGAGG - Intronic
1119323965 14:73747682-73747704 TCTGGTGGGGTGGGGGTCGGGGG + Intronic
1119416196 14:74471266-74471288 TCTGGAGGAGTGGCCGGCAGAGG + Intergenic
1120097382 14:80403896-80403918 TCCAGAGGGATGGAAGTCAGTGG - Intergenic
1120107981 14:80517941-80517963 TCCAGAGGGGTGGAAGTCAGTGG + Intronic
1120341440 14:83225731-83225753 TTCAGAGGGATGGAAGTCAGTGG - Intergenic
1120397388 14:83985617-83985639 TCCAGAGGGATGGAAGTCAGCGG - Intergenic
1120849264 14:89154845-89154867 TCTGGATGGGTGCCAGTGAGGGG - Intronic
1120857340 14:89223721-89223743 CCCTGAGGTGTGGAAGTCAGGGG + Intronic
1121583495 14:95047494-95047516 TCTGCAGGGATGGGACTCAGCGG + Intergenic
1122136347 14:99635139-99635161 TCTGCAGGGGTGGAGGTCCCAGG + Intergenic
1122437819 14:101711574-101711596 TGGGGAGGGGTGGCAGTCAAAGG + Intergenic
1123125465 14:105942902-105942924 TCCGGAGGGATGGAAGCCAGCGG - Intergenic
1123798514 15:23797873-23797895 TATGGAGGCGGGGAAGTGAGAGG + Intergenic
1123987297 15:25657066-25657088 TCCGGAGGGGTGGAAGTCAATGG - Intergenic
1124104999 15:26729425-26729447 GATGGAGAGGTGGCAGTCAGTGG - Intronic
1124141916 15:27084766-27084788 TCTGCAGTGATGGAGGTCAGTGG - Intronic
1124321764 15:28718320-28718342 GGTTAAGGGGTGGAAGTCAGGGG + Intronic
1124421227 15:29524718-29524740 TCTAGAGGGGTGTCAGTCAGTGG + Intronic
1124462796 15:29908507-29908529 GCTGCAGGGGTGGACATCAGTGG - Intronic
1124522862 15:30420158-30420180 GGTTAAGGGGTGGAAGTCAGGGG + Intergenic
1124535803 15:30546059-30546081 GGTTAAGGGGTGGAAGTCAGGGG - Intergenic
1124762847 15:32461541-32461563 GGTTAAGGGGTGGAAGTCAGGGG + Intergenic
1124775779 15:32587517-32587539 GGTTAAGGGGTGGAAGTCAGGGG - Intergenic
1125245392 15:37630793-37630815 TTTTGTGGGGTGGGAGTCAGAGG - Intergenic
1125253853 15:37739616-37739638 TCTGGAGGGGGTGAAGGAAGTGG + Intergenic
1125482331 15:40089195-40089217 TCTGAGGGGGTGGAGGTCGGGGG + Exonic
1125685221 15:41559596-41559618 TCTGGCGGGGTGGAAGAGAAGGG + Intronic
1126153884 15:45547358-45547380 TCTGGAGGGGGGGAAGTCAATGG + Intergenic
1126471893 15:49021230-49021252 TCTGGAGGGTGGGAAGTCCAAGG - Intronic
1126687462 15:51261003-51261025 TCCGGAGAGGTGGGAGTCAATGG - Intronic
1126728337 15:51655599-51655621 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1127074513 15:55312200-55312222 TCCGGAGGGATGGAAGTCAGCGG + Intronic
1127873077 15:63089394-63089416 TCTGGAAGGGATGAAGTCATCGG + Intergenic
1128363106 15:66976447-66976469 TCCGGAGGGGTGGAAGTCAGTGG + Intergenic
1129887935 15:79051807-79051829 TCTGGAGGGTTGCAAGCCTGGGG + Intronic
1130429710 15:83834379-83834401 TATGGAGCTGTGGTAGTCAGTGG - Intronic
1130780121 15:87027877-87027899 TCTCGAGGGGTGTAGGTGAGGGG + Intronic
1130988161 15:88858190-88858212 TCTGGGATGGTGGATGTCAGTGG + Exonic
1131132212 15:89907607-89907629 TCTGGAGGCGGGGAAGTCCAAGG - Intronic
1131185641 15:90271683-90271705 GCTGGAGGAGTTGAAGGCAGAGG + Exonic
1131673852 15:94651175-94651197 TCCAGAGGGATGGAAGTCAGTGG - Intergenic
1132212079 15:100031557-100031579 GATGAAGGGGTGGAAATCAGAGG - Intronic
1132268356 15:100499952-100499974 TCTGCAGGTGTGGAAATGAGAGG - Intronic
1132326857 15:100977675-100977697 CCTGGTGGGGTGGAAATCTGGGG - Intronic
1133415911 16:5606872-5606894 TCTGGAAGAGGGGATGTCAGGGG + Intergenic
1133441129 16:5821726-5821748 TCTGGAGGGTGGGAAGTCCAAGG + Intergenic
1134014359 16:10878297-10878319 GTTGGAGGGGGAGAAGTCAGAGG + Intronic
1134571928 16:15298455-15298477 TCTGGAGGCTGGGAAGTCCGAGG - Intergenic
1134679127 16:16111590-16111612 TCAGGCGGGGTGGGAGACAGCGG - Intronic
1134936977 16:18254308-18254330 TCTGGAGGCTGGGAAGTCCGAGG - Intergenic
1136158245 16:28400267-28400289 TTGGGAGGGGTGGAATTTAGTGG - Intronic
1136204842 16:28715016-28715038 TTGGGAGGGGTGGAATTTAGTGG + Intronic
1136777857 16:32881228-32881250 TCTGCAGGGATGCATGTCAGTGG + Intergenic
1136892766 16:33980286-33980308 TCTGCAGGGATGCATGTCAGTGG - Intergenic
1138206706 16:55130811-55130833 TCTCGAGGGGAGGGGGTCAGTGG - Intergenic
1138510931 16:57508088-57508110 TCTGGAGGGCTGGAGTGCAGAGG + Intergenic
1138947375 16:61867945-61867967 TCTGGAGGGGAGGATGAGAGGGG - Intronic
1139271429 16:65687073-65687095 TCTGGAGGGAAGGAAGTTGGAGG + Intergenic
1140009751 16:71119246-71119268 ACTGGAGGGATGGGAGTGAGTGG + Intronic
1140241850 16:73209367-73209389 TCTGGAGGGTGGGAAGTCCAAGG + Intergenic
1140912629 16:79467835-79467857 TATGGAGGGGAGGAAGGGAGAGG + Intergenic
1141468812 16:84224703-84224725 ATTGCAGGGGTGGGAGTCAGAGG + Intronic
1141710024 16:85693185-85693207 TCTGGAGGGCTGGAGTGCAGTGG + Intronic
1141805551 16:86339053-86339075 TCTGGAGGCCTGGAAGACTGGGG - Intergenic
1142278312 16:89134462-89134484 TCCGGAGGAATAGAAGTCAGCGG + Intronic
1203080272 16_KI270728v1_random:1143337-1143359 TCTGCAGGGATGCATGTCAGTGG + Intergenic
1142648006 17:1327878-1327900 TCTGGAGGCTGGGAAGTCTGAGG - Intergenic
1142789327 17:2251419-2251441 TCTGGAGTGGAGGAAGTAAAGGG - Intronic
1143016821 17:3895259-3895281 TCTGGAAGGGTTGCAGTGAGGGG + Intergenic
1143460755 17:7101951-7101973 TTTGGAGGGGTTGGAGTCTGGGG + Intronic
1143486843 17:7260094-7260116 TCTGGACGGGAGGAAAGCAGAGG + Exonic
1143680357 17:8471616-8471638 TCAGTAGGGGTTGAAGTCCGGGG + Intronic
1144483159 17:15644127-15644149 GCTGAAGGGGTGGAAGTCCATGG - Intronic
1144582580 17:16467645-16467667 TCTGCAGGACTGAAAGTCAGAGG - Intronic
1144915525 17:18720902-18720924 GCTGAAGGGGTGGAAGTCCGTGG + Intronic
1145825968 17:27877601-27877623 CTTGGAGTAGTGGAAGTCAGAGG + Intronic
1146475975 17:33163077-33163099 TCTGGTGGGGTGGGAGTAGGGGG + Intronic
1146554962 17:33815373-33815395 GCTGGAGGATTGGAACTCAGGGG - Intronic
1146922900 17:36725493-36725515 TTGGGAGGGGAGGAAGTGAGGGG - Intergenic
1147310317 17:39592231-39592253 TCTGGAGGTGGGGGAGGCAGCGG - Intergenic
1148371988 17:47106724-47106746 TCCGGAGGAATGGAAGTCAGTGG + Intergenic
1149243105 17:54673738-54673760 TCTGGAGGGATGGAAGTCAGTGG + Intergenic
1150613104 17:66749283-66749305 TCCGGAGGGGTGGAGGGCAGGGG - Intronic
1152923660 17:83078298-83078320 TCTGCAGGGACGGAAGTCACCGG - Intergenic
1155237119 18:23831567-23831589 TCTGCAGAGGTGTAAGACAGGGG - Intronic
1155389115 18:25315026-25315048 TGGGGAGGGCTGGAAGCCAGAGG - Intronic
1156664309 18:39386699-39386721 TCAGGAGTGCTGGAAGTAAGAGG - Intergenic
1157453867 18:47809152-47809174 TCTGGGGAGGTGGAGGTCAAAGG + Exonic
1157487219 18:48096619-48096641 TGTGGAGGGGTGGGAGTCACAGG + Intronic
1157782200 18:50449477-50449499 TCCGAAGGGATGGAAGTCAGTGG + Intergenic
1157806458 18:50661576-50661598 GGTGGAGGGGTGGATGTCAGTGG + Intronic
1158470805 18:57735230-57735252 ATTGGAGGGATGGAAGTCAGCGG - Intronic
1158655464 18:59326951-59326973 GCTGTTGGGGTGGAAGTAAGAGG + Intergenic
1158749509 18:60242708-60242730 TCTGGAGAGGAGCAAGTGAGGGG - Intergenic
1159107913 18:64025303-64025325 TTTGGAGGGTTGGGGGTCAGTGG - Intergenic
1159276123 18:66223472-66223494 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
1159279774 18:66270440-66270462 TCTGGAGGGATGGAAGTCAGTGG + Intergenic
1160480977 18:79239273-79239295 TGTGGAGCGGTGGAAATAAGAGG - Intronic
1160835277 19:1122041-1122063 AGAGGAGGGGTGGGAGTCAGGGG - Intronic
1161807017 19:6450235-6450257 TTTGGAGGAGTGGAAGTCTTAGG - Intronic
1161877622 19:6924146-6924168 GATGGAGGAGTTGAAGTCAGGGG + Intronic
1162104813 19:8364013-8364035 TCTGGAGGCCTGGTAGTCTGCGG - Intronic
1162523594 19:11195309-11195331 GGTGGAGGGGAGGAAGTAAGAGG + Intronic
1163015429 19:14451430-14451452 TCTGGAGGGGTAGATGGCTGAGG - Intronic
1163116582 19:15192339-15192361 TCTGGAGGGGAGGTAGTCGGGGG - Intronic
1163702385 19:18792505-18792527 TCTGGAGGGGAGCAAGTTAAAGG + Intergenic
1163829656 19:19541544-19541566 TCTGGACAGGTGGATGCCAGGGG + Intronic
1164056877 19:21629510-21629532 TCTGGAGGGATGAAAGTCAGTGG - Intergenic
1164173174 19:22745557-22745579 TCTGGAGGGGTGGAAGTCAGCGG - Intergenic
1166014320 19:39968896-39968918 TCCGGAGGGGTGGAAGTCAGCGG - Intergenic
1166165568 19:40985918-40985940 TCCGGACGGGTGGAAGTCAGTGG - Intergenic
1166165661 19:40986589-40986611 TCTGGAGGGGTGGAAGTCAGTGG + Intergenic
1166668191 19:44694186-44694208 GCTGGAGGGGAGGAAGTGAAGGG - Intergenic
1167780043 19:51593218-51593240 TCTGGAAGGGTGAAACTAAGCGG - Intergenic
924973616 2:153865-153887 TCCGGAGGGGTGGAAGTCAGTGG + Intergenic
924974503 2:160349-160371 TCCGGAGGGGTGGAAGTCAGTGG + Intergenic
925023814 2:592620-592642 TCTGGAGAGATGGAAGTCAGCGG - Intergenic
925783378 2:7404496-7404518 CCTGGAGAGGTGGCAGTAAGTGG - Intergenic
925971281 2:9108240-9108262 TCTGGAGGGGATGAAATCACCGG - Intergenic
925979043 2:9162493-9162515 TATGGAGGCTGGGAAGTCAGAGG - Intergenic
926090328 2:10044825-10044847 TCTGGAGGGGAGGAGGGAAGAGG - Intronic
927196732 2:20552970-20552992 TCTGGAGGGTGGGAAGTCCAAGG + Intergenic
927880700 2:26688134-26688156 TCTGTAGGGAGAGAAGTCAGGGG - Intergenic
928319127 2:30269297-30269319 TCCAGAGGGATGGAAGTCAGCGG - Intronic
928348192 2:30519915-30519937 TCCAGAGGGGTGAAAGTCAATGG - Intronic
928440106 2:31285127-31285149 TCCGGAGGGGTGGAAGTTAGCGG - Intergenic
928671901 2:33610995-33611017 TCCGGAGGGGTGGAAGTCAATGG + Intergenic
929531232 2:42754367-42754389 GCTGGAGGGGTGGGGGTCATGGG - Exonic
929542361 2:42832131-42832153 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
929699799 2:44152168-44152190 TCTGGAGGCTGGGAAGTCTGAGG - Intergenic
930566180 2:53023358-53023380 GCTGCAGGGGTGGAAGGCAGTGG - Intergenic
932043441 2:68323185-68323207 TCTGGAGGCTTGGAAGTCTAAGG - Intergenic
932710302 2:74058743-74058765 CCTGGAGGGGTGGACTTCGGAGG - Intronic
932846633 2:75142114-75142136 ACTGGAGGGGAGGCAGTGAGTGG + Intronic
932917180 2:75872090-75872112 TCCGGAGGGATAGAAGTCAGTGG - Intergenic
933121767 2:78547012-78547034 TCCAGAGGGGTGGAAGTCAACGG + Intergenic
933175730 2:79170181-79170203 TCCTGAGGGATGGGAGTCAGTGG + Intergenic
934032131 2:88057537-88057559 ACTGGAGCAGTTGAAGTCAGAGG - Intergenic
934174709 2:89568609-89568631 AATGGATTGGTGGAAGTCAGGGG + Intergenic
934285026 2:91642961-91642983 AATGGATTGGTGGAAGTCAGGGG + Intergenic
934477565 2:94603529-94603551 TCCTGAGGGGTGGAGGGCAGGGG - Intronic
934501573 2:94863884-94863906 GCTGGGGGGGGGGAAGGCAGGGG + Intergenic
935594075 2:104866376-104866398 GGTGAAGGGGTGGAAGTGAGGGG + Intergenic
936157467 2:110057765-110057787 TCGACAGGGGTGGAAGTCAATGG + Intergenic
936187225 2:110313679-110313701 TCGACAGGGGTGGAAGTCAATGG - Intergenic
936241494 2:110792019-110792041 TCTGGAGGGATGGAAGCCTGGGG - Intronic
936374703 2:111930529-111930551 TGGGGAGAGGTGGAAGGCAGGGG - Intronic
936387733 2:112044811-112044833 TCCAGAGGGATGGAAGTCAGTGG + Intergenic
936661327 2:114547249-114547271 CCTGGAGGGGTGGAAGTAGCAGG - Intronic
936868894 2:117109692-117109714 TCCTGAGGGATGGAAATCAGTGG - Intergenic
937262841 2:120597440-120597462 TCTGGAGCGGAGGAAGAGAGAGG - Intergenic
937446409 2:121962514-121962536 TCTAGAGGTCAGGAAGTCAGAGG + Intergenic
939134081 2:138273483-138273505 TCCAGAGGGATGGAAATCAGCGG + Intergenic
939492966 2:142899003-142899025 TCCAGAGGGGTGGGAGTCAATGG + Intronic
939493154 2:142900251-142900273 TCCAGAGAGGTGGAAGTCAGTGG + Intronic
939494102 2:142907464-142907486 TCCAGAGGGGTGGGAGTCAATGG + Intronic
939856134 2:147360906-147360928 ACTGGATGAGTGGAAGTCAAAGG + Intergenic
940039646 2:149347025-149347047 TCTGGAAGCTTGGCAGTCAGAGG + Intronic
940049894 2:149451201-149451223 TCTGGAGGGGAGGAACACTGTGG + Intronic
940418867 2:153455514-153455536 CCATGAAGGGTGGAAGTCAGTGG - Intergenic
940481720 2:154241060-154241082 TGTGGAGAGGAGCAAGTCAGCGG - Intronic
940669045 2:156645177-156645199 TCCGGAGGGATGGGAGTCAGTGG - Intergenic
941395560 2:164968874-164968896 TTCGGAGGAGTGGAAGTCAGCGG + Intergenic
942830311 2:180232091-180232113 CCCTGAGGGGTGGAAGTCAATGG - Intergenic
942831229 2:180238950-180238972 TCCGGAGGGGTGGAAGTCAATGG - Intergenic
943195453 2:184741458-184741480 TCTAGAGGGGATGAAGTCTGAGG - Intronic
944039788 2:195339904-195339926 TCCGGAGGGGTGGAAGTCAATGG + Intergenic
944541821 2:200761299-200761321 TCTGGATGGGTGGAGGGGAGTGG + Intergenic
945064777 2:205939578-205939600 TCCGGAGGGATGGAAGTCAGCGG - Intergenic
945395003 2:209306622-209306644 TCCGGAGGGATGGAAGTCAGCGG - Intergenic
946174835 2:217916278-217916300 TCTGGAGGGGAGGAGGTGAATGG - Intronic
946302175 2:218830706-218830728 TCTGGGGAGGTGGGAGCCAGGGG - Intronic
946527202 2:220533574-220533596 GCTGGAGGCGTGGATGTCAGGGG + Intergenic
946739546 2:222788227-222788249 GCTGGATGGTGGGAAGTCAGGGG - Intergenic
946861038 2:224000682-224000704 TGTCGAGGGGTGGAAGGCAAGGG - Intronic
948517648 2:238514234-238514256 TCCAGAGGGGTGGAAGTCAGCGG - Intergenic
948580260 2:238982507-238982529 TTGGGAGGGGTGGAAGGCAAGGG - Intergenic
1169207710 20:3749486-3749508 CCTGGAGGAGTGGGAGTTAGGGG - Intronic
1169325019 20:4668513-4668535 TATGAAGGGGCGGCAGTCAGGGG + Intergenic
1170360867 20:15544836-15544858 ACTGAAGGGCTAGAAGTCAGAGG - Intronic
1170466847 20:16629971-16629993 GCTGGAGGGGTGGAGTGCAGTGG + Intergenic
1170880352 20:20291688-20291710 CCTGGAGGGGAGGAAAACAGTGG - Intronic
1171200272 20:23235066-23235088 TCTAGTGGGGAGTAAGTCAGTGG + Intergenic
1171286379 20:23942383-23942405 TCTGAGCAGGTGGAAGTCAGGGG - Intergenic
1171500789 20:25591456-25591478 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1172483356 20:35284656-35284678 TCGGGAGGGGTGGGGGCCAGAGG - Intronic
1172683693 20:36737266-36737288 TCTTCAGGAGTGGAAGGCAGGGG - Intronic
1172888513 20:38247407-38247429 TGAGGAGGGGTGGAAGTGAAGGG - Intronic
1172947200 20:38698781-38698803 TCCAGAGGGGTGGAAGTCAGCGG - Intergenic
1173155043 20:40601541-40601563 TCTGGAAGAGTGGAAGTAGGGGG + Intergenic
1173160001 20:40645405-40645427 TGTGGAGGGCTGGGAGTGAGAGG - Intergenic
1173276252 20:41586276-41586298 TCCGGAGGGGTGAAAGTCAACGG - Intronic
1174319030 20:49726056-49726078 TCTGGAAGAGTAGAAGTCAGGGG - Intergenic
1175606451 20:60315685-60315707 TCAGGAGGGGAAGGAGTCAGGGG - Intergenic
1175836665 20:62000372-62000394 GCTGGTGGGGTGGAAGGCAGTGG + Intronic
1176074962 20:63244281-63244303 TGGGGTGGGGTGGAAGGCAGGGG - Intronic
1177263007 21:18753089-18753111 TCCGGAGGGATGGGAGTCAGTGG + Intergenic
1177263974 21:18760116-18760138 TCCGGAGGGATGGGAGTCAGCGG + Intergenic
1177359355 21:20048613-20048635 TCCGGAGGGGTGGAAGTCAGTGG + Intergenic
1177531190 21:22360113-22360135 TCTGGAGGGATGGCAGTCAGCGG + Intergenic
1177725949 21:24968093-24968115 TCTGGATCTGTGCAAGTCAGTGG - Intergenic
1177738129 21:25118812-25118834 TCCGGAGGGGTGGAAGTCAGCGG - Intergenic
1178886660 21:36490103-36490125 TCTAGAGATGAGGAAGTCAGAGG + Intronic
1179049606 21:37877735-37877757 TCTGGAGAGGAAGAAGTGAGAGG - Intronic
1179157800 21:38865000-38865022 TCTGGAGGCTTGGAAGTCCAAGG - Intergenic
1179259606 21:39746240-39746262 TCTGGAGGAATGGAAGTCAGCGG + Exonic
1179444719 21:41423206-41423228 TCCAGAGGGGTGGACATCAGTGG + Intronic
1181540593 22:23570975-23570997 TGTGGAGGGGTGGAGGTTGGGGG - Intergenic
1182895800 22:33858251-33858273 TCCAGAGGGATGGAAGTCAGCGG + Intronic
1182906928 22:33946162-33946184 TCTAGACAGGTGGAGGTCAGTGG - Intergenic
1183280445 22:36929380-36929402 ACTGGAGGGGAGGAAGTGAAGGG - Exonic
1183520333 22:38293153-38293175 TGTGGAGGGGTGGGTGGCAGTGG - Intronic
1183527866 22:38334716-38334738 TCTGGAGGCCTGGAGGTCATTGG + Intronic
1184880989 22:47304163-47304185 CCTGGAGGGGTGGGGGACAGAGG - Intergenic
1185005025 22:48270790-48270812 TCTGGAGGGGTGAGTGTGAGGGG - Intergenic
1185413804 22:50699096-50699118 GCTGGTGGGGTGCAAGTCACTGG - Intergenic
949549882 3:5104103-5104125 AGAGGAGGGGAGGAAGTCAGGGG - Intergenic
949894341 3:8758157-8758179 CATGGAGGGGTGGGAGGCAGAGG + Intronic
950242711 3:11386068-11386090 TGTGGAGGGCAGGAAGTCAGGGG + Intronic
950922062 3:16704760-16704782 TCAGGAAGGGAGGAAGGCAGAGG - Intergenic
951326070 3:21303098-21303120 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
951522051 3:23619422-23619444 ACTGGAGGTGTGGGAGACAGAGG + Intergenic
951837648 3:27001172-27001194 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
952622773 3:35366205-35366227 TCTGGAGGCTGGGAAGTCTGAGG + Intergenic
952880143 3:37980129-37980151 TGGGGAGGGGTGGTAGCCAGGGG - Intronic
952921711 3:38289745-38289767 TCCGGAGGGGTGGAAGTCAGCGG + Intronic
952922693 3:38296892-38296914 TTCGGAGGGGTGGAAGTCAGCGG + Intronic
953515827 3:43591224-43591246 TCTGGAGGGATGGAAGTCAATGG - Intronic
954096965 3:48336064-48336086 TCCGGAGGTGTGGAAGCCAATGG + Intergenic
954466316 3:50657097-50657119 TCTGGAGGGAAGATAGTCAGAGG + Intergenic
954980895 3:54744446-54744468 TTTTGCGGGGAGGAAGTCAGAGG + Intronic
956564246 3:70617519-70617541 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
956606453 3:71077787-71077809 TTAGGAGGGGAGGAAGTGAGAGG - Intronic
956624143 3:71250045-71250067 TCTGGTGGGGTGGACTTCTGTGG - Intronic
957296906 3:78344234-78344256 TCTAGAGGGATGGAAGTCAGTGG + Intergenic
957646804 3:82940142-82940164 TCTGGATGAGGGGAACTCAGTGG - Intergenic
957687047 3:83515324-83515346 TCCGGAGGGATGGAAGTCAGCGG - Intergenic
958016742 3:87946202-87946224 TCCAGAGGGGTGGAAGTCAGCGG + Intergenic
958832359 3:99104973-99104995 TCTGGTAGGGAGGAAGTCTGGGG - Intergenic
959161769 3:102732783-102732805 TCCGGAGGGATGGAAGTCAGTGG + Intergenic
959406346 3:105966198-105966220 TCTGGAAGGGTGGAAGTCAGTGG - Intergenic
959450010 3:106487169-106487191 TCCGGAAGAATGGAAGTCAGCGG + Intergenic
960103158 3:113766150-113766172 TCTGGAGTGTGGGAAGTCCGAGG + Intronic
961002220 3:123381716-123381738 TCAGGAGCGATGGAAGCCAGCGG - Intronic
961828977 3:129613579-129613601 TCTGCAGGGGTGGGGGTCGGGGG - Intergenic
962370520 3:134817421-134817443 TGTGGAGGGCTGGAAGTGGGTGG + Intronic
962437979 3:135383961-135383983 CCTGAAGGAGTGGAAGTGAGAGG + Intergenic
962801952 3:138898054-138898076 TCTAGAGGGAGGGAATTCAGTGG + Intergenic
962965498 3:140349929-140349951 GGTGGAGGGGAGGATGTCAGAGG - Intronic
963024092 3:140901181-140901203 TCTGGAAGGGTGGAAGTCAGCGG - Intergenic
963168178 3:142225646-142225668 GCGGGAGGGGTGGAGGTGAGCGG + Intergenic
963255685 3:143142521-143142543 TCCGGAGGGGTGGAAGTCAGCGG - Intergenic
963575889 3:147060186-147060208 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
963736276 3:149020861-149020883 TCAGGAGGGGTGGGCGTCCGAGG + Intronic
963877796 3:150496079-150496101 TCTGGAGTGGGGGGAGCCAGGGG - Intergenic
963915315 3:150854407-150854429 TCCAGAGGGATGGAAGTCAGCGG - Intergenic
964920699 3:161891967-161891989 TCTGAAGGCGTGGAAGTTAGGGG - Intergenic
964980016 3:162667026-162667048 TCTGGAGGGGTGGAAGTCAGCGG + Intergenic
965342129 3:167503673-167503695 TCCAGAGGGATGGAAGTCAGCGG + Intronic
965927910 3:174006017-174006039 TTTGGAGGGGGTGAAGGCAGAGG - Intronic
966309958 3:178582356-178582378 TGTGGCGGGGTGGGAGTTAGGGG + Intronic
966511219 3:180765639-180765661 TCCGGAGGGGTGAAAGTCAATGG + Intronic
967389157 3:188938549-188938571 TCCAGGGGGATGGAAGTCAGCGG + Intergenic
967623103 3:191658945-191658967 TGCGGAGGGATGGAGGTCAGTGG - Intergenic
968034995 3:195540803-195540825 TCTGGAGGCTTGGAAGTCCAGGG - Intronic
968092953 3:195909538-195909560 TCTGGAGGGGTGGGAGCGCGCGG - Intronic
968124964 3:196152185-196152207 TCTAGAGTGGTGGTTGTCAGCGG + Intergenic
968235324 3:197027727-197027749 TCTGGCAGGGTGGAAGGGAGAGG + Intronic
968390869 4:192109-192131 TCCAGAAGGTTGGAAGTCAGTGG + Intergenic
968611648 4:1559940-1559962 TGTGGTGGGGTGGAGGTGAGAGG - Intergenic
969162622 4:5274831-5274853 TCTGGAGGGATGAAAGTCAGCGG - Intronic
969381142 4:6798907-6798929 GGTGTAGGGGAGGAAGTCAGAGG + Intronic
969644666 4:8420779-8420801 TCCGGAGGGGTGGAAGTCAGTGG - Intronic
969645659 4:8427436-8427458 TGGAGGGGGGTGGAAGTCAGCGG - Intronic
970026029 4:11625124-11625146 TTTGGTGGGGTGGGAGTCAGGGG + Intergenic
970095531 4:12459582-12459604 TCCGCAGGGATGGAAGTCTGCGG - Intergenic
970738109 4:19198105-19198127 TCCAGAGGGATGGAAGTCAGCGG + Intergenic
970976751 4:22050499-22050521 TGTGGAGGGGTGGAGGGCAGAGG + Intergenic
971076781 4:23158411-23158433 TCCGGAAGGGTGGAAGTAAATGG - Intergenic
972343189 4:38170578-38170600 TCTGGAGGGTTAGAAGTCCAGGG - Intergenic
972568148 4:40287145-40287167 GCTGGAGGGCTGGAATGCAGTGG - Intergenic
972764641 4:42141216-42141238 TGTGGAGGGGAGGAAGTAAGAGG - Intronic
972766768 4:42158534-42158556 TCCAGAGGGATGGAAGTCAGTGG + Intergenic
972780833 4:42285715-42285737 TCTGCAGAGGTGGAAGTCAGTGG + Intergenic
972851375 4:43054951-43054973 TCTGGAGGGTGGGGAGTCATAGG - Intergenic
972853844 4:43082254-43082276 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
973205066 4:47550814-47550836 TCCGCAGGGGTGGAAGTCAGCGG + Intronic
973634790 4:52851988-52852010 GCTGGTGGTGGGGAAGTCAGAGG - Intergenic
974190090 4:58493387-58493409 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
974487847 4:62526861-62526883 TCCAGAGGGATGGAAGTCAGTGG + Intergenic
974520765 4:62977414-62977436 TCTGGAGGGGTGGAAGTCAGTGG - Intergenic
974648494 4:64724948-64724970 TCCAGAGGGGTGGTAGTCAGTGG + Intergenic
975331508 4:73119999-73120021 TCTGGAGGGTTGGAAAACAATGG + Intronic
975418815 4:74138642-74138664 TCCGGAGGAGTGGAAGTCAATGG + Intronic
976189293 4:82473728-82473750 TCCGGAGGGGTGGAAGTCAGTGG - Intergenic
976190172 4:82479749-82479771 TCCGGAGGGGTGGAAGTCAGCGG - Intergenic
976464847 4:85355207-85355229 TCCGGAGGGGTGGAAGTCAGTGG + Intergenic
976963619 4:91009094-91009116 TCTGGAGGGATGGAAGTCAGGGG + Intronic
977127549 4:93188547-93188569 TATGGATTGGTGGAAGCCAGGGG - Intronic
977251324 4:94692661-94692683 TCCAGAGGGGTGGAATTCAGCGG - Intergenic
977342093 4:95771771-95771793 TCTGGAGGAGTGGAAGTTAGTGG - Intergenic
977556180 4:98489614-98489636 TCCGGAGGGGTGGAAGTCAGTGG - Intronic
977591618 4:98833722-98833744 TCTCCATGGGAGGAAGTCAGGGG - Intergenic
978587024 4:110284266-110284288 TTCGGAGGGATGGAAGTCAGCGG + Intergenic
978909024 4:114044534-114044556 TCCGGAGGGATGGAAGTCAGCGG - Intergenic
979136004 4:117113863-117113885 TCTGGAGGGATAGAAGTCAGCGG + Intergenic
979910833 4:126363708-126363730 TCTGGAGGGATGGAAGTCAGTGG - Intergenic
980386299 4:132090737-132090759 TCCAGAGGGATGGAAGTCAGAGG + Intergenic
980443823 4:132882451-132882473 TTCAGAGGGGTAGAAGTCAGTGG - Intergenic
980523654 4:133961749-133961771 TCTGGAGGGGTGGAAGTCAACGG - Intergenic
980625719 4:135372334-135372356 ACCAGAGGGATGGAAGTCAGGGG - Intergenic
980790436 4:137613304-137613326 TCCGCAGGGATGGAAGTCAGCGG - Intergenic
980871967 4:138622102-138622124 TCTGGAGGGGTGGAAGTCAGTGG + Intergenic
980999591 4:139816066-139816088 TCAGGAGGGGAGGAAGAGAGGGG + Intronic
981740762 4:147999470-147999492 TCCGGAGGGATGGAAGTCAGTGG - Intronic
981823747 4:148915626-148915648 TCTGGGGGAGTGGAAGTCAGTGG - Intergenic
982332116 4:154192505-154192527 TCTGGAGGGGTAGAAGTCAATGG - Intergenic
983017284 4:162628728-162628750 TCTGGGGTGGTGGTGGTCAGAGG + Intergenic
983777799 4:171629916-171629938 TCCAGAGGGATGGAAGTCAGCGG - Intergenic
984280665 4:177666608-177666630 TCTGGAGGGGTGGAAGTCAATGG + Intergenic
985959106 5:3286383-3286405 ATCGGAGGGGTGGAAGACAGAGG + Intergenic
986492614 5:8307812-8307834 TCCTGAGGTGTGGAAGTCAACGG + Intergenic
987129615 5:14848556-14848578 TCTGGAGGGGTGGAAGTCAGCGG - Intronic
987719411 5:21615318-21615340 TCCAGAAGGGTGGAAGTCAGCGG + Intergenic
987761178 5:22164449-22164471 TCCTGAGGGATGGAAGTCAGCGG + Intronic
987905354 5:24069403-24069425 TCCAGAGGGGTGGAAGTCAGTGG - Intronic
987934913 5:24451322-24451344 TCCGGAGGGGTGGAAGTCAGCGG + Intergenic
988047862 5:25981207-25981229 TGTTGAGGGGTGGAAGTGAGGGG + Intergenic
988081077 5:26416255-26416277 TCTGGAGGTGGGGAATGCAGTGG + Intergenic
988099681 5:26660316-26660338 TCCGGAGGGGTGGAAGTCAGCGG + Intergenic
988182549 5:27816279-27816301 TCCAGAGGGGTGGAAGTCAATGG + Intergenic
988273422 5:29047938-29047960 TCTGGAAAGGTTGAGGTCAGAGG - Intergenic
988740538 5:34064635-34064657 TCTGGAGGGGTGGAAGTCAATGG + Intronic
988957392 5:36332944-36332966 TCCAGAAGGATGGAAGTCAGCGG + Intergenic
988958951 5:36349810-36349832 TCTGCAGCTGTAGAAGTCAGAGG - Intergenic
989225384 5:39021714-39021736 TCTGGAGGCAGGGAAGTCTGAGG - Intronic
989713245 5:44427177-44427199 TGTTGAGGGGTGGAAATGAGAGG - Intergenic
990154058 5:52854433-52854455 GGTGGAGGGGTGGAAATGAGGGG - Intronic
990478809 5:56187577-56187599 TCCAGAGGGATAGAAGTCAGCGG - Intronic
990741378 5:58915956-58915978 TCCAGAGGGATAGAAGTCAGCGG - Intergenic
990891813 5:60658907-60658929 TCCGGAGGGGTGGAAGTCAGTGG - Intronic
990892808 5:60666113-60666135 TCTGGAGGGGTGGAAGTCAGTGG - Intronic
990905183 5:60795651-60795673 TCCGGAGGGTTGGAAGTCAGTGG - Intronic
991290617 5:65030892-65030914 TCTGGACGGATGGAAGTCAGTGG - Intergenic
991660880 5:68949662-68949684 AGGGGAGGGGTGGAGGTCAGAGG - Intergenic
991895968 5:71397903-71397925 TCCTGAGGGATGGAAGTCAGCGG + Intergenic
992612482 5:78519466-78519488 CCTGGACGGGTGGAGGTGAGGGG - Intronic
993225646 5:85165362-85165384 TCTGGAGGGATGGGAGTCAGCGG - Intergenic
993460757 5:88177694-88177716 TCTGGAGGGATGGGAGTCAGGGG + Intergenic
993590953 5:89794667-89794689 TCTGGAGGGATGGAAGTCAGTGG - Intergenic
993879865 5:93349222-93349244 TCTGGAGAGGTGAATGTGAGGGG - Intergenic
993941852 5:94068356-94068378 TCCGGAGGGGTGGAAGTCAGTGG + Intronic
994552074 5:101247603-101247625 TCTGGAGGCTGGGAAGTCTGAGG - Intergenic
994940298 5:106315194-106315216 TATGTAGGGCTAGAAGTCAGAGG - Intergenic
995125591 5:108574453-108574475 TCTGGAGGGATGGAAGTCAGTGG + Intergenic
995169507 5:109091115-109091137 TCTGGATGGAAGGAAGACAGAGG + Intronic
995465170 5:112444107-112444129 TCTGGATGGATGGAAGTCAGCGG - Intergenic
995466156 5:112451129-112451151 TCTGGAGGGATGGAAGTCAGCGG - Intergenic
995554942 5:113318024-113318046 TATGAAGAGGTGGAGGTCAGAGG + Intronic
995785078 5:115819054-115819076 TCTGGAGGGGTGGAAGTCGGTGG + Intergenic
995797367 5:115956282-115956304 TCTGCAGGGCACGAAGTCAGGGG + Intergenic
996007316 5:118437433-118437455 TTTGGTGGTGTGGAAGTTAGAGG - Intergenic
996128275 5:119751561-119751583 TCTGGAGGGATGGAAGTCGGTGG - Intergenic
996708785 5:126523563-126523585 GCTGGAGGGCTGGAGGACAGTGG + Intergenic
998429636 5:142059968-142059990 TCTGGAGGGATGGGAGGCAGTGG - Intergenic
998644319 5:144045570-144045592 TCTGGAGGGATGGAAGTCAGTGG - Intergenic
998885097 5:146685880-146685902 TTTGGTGGGGTGGAAGGCGGGGG - Intronic
998927685 5:147144639-147144661 ACTTCAGGGGTAGAAGTCAGTGG - Intergenic
1000095456 5:157967406-157967428 TCCGGAGGGATGGAAGTCAGCGG - Intergenic
1000957442 5:167559675-167559697 CCTGTAGGGGTGGGAGTAAGGGG + Intronic
1001597152 5:172905662-172905684 TCCAGAGGGGTGGAAGTCAGCGG + Intronic
1002385583 5:178863771-178863793 GGTGGAGAGGTGGAAGACAGTGG + Intronic
1004007316 6:11649073-11649095 TCCAGAGGGGTGGAAGTCAGAGG - Intergenic
1004236363 6:13878492-13878514 TCTGGAGGGGTGGAAGTCAGTGG - Intergenic
1004256416 6:14068844-14068866 TCCGGAGGGATGGAAGTCAGCGG - Intergenic
1004708123 6:18143237-18143259 TCTTTAGGGGTGGGAGTGAGGGG + Intronic
1004834800 6:19518349-19518371 TCTGGAGGTGGGGAAGTGAATGG - Intergenic
1005033105 6:21529830-21529852 CCGGGATGGGTGGAAGTTAGAGG - Intergenic
1005056048 6:21729658-21729680 TCATGAGGGATGGAAGTGAGAGG - Intergenic
1005324134 6:24682640-24682662 TCCGGAGGGATGGGAGTCAGTGG + Intronic
1005856545 6:29867212-29867234 TCTGCAGAGGAGGAAGGCAGAGG + Intergenic
1005862386 6:29911529-29911551 TCTGCAGAGGAGGAAGGCAGAGG + Intergenic
1006405341 6:33841744-33841766 CATGGAGGGGTGGGAGGCAGTGG - Intergenic
1007011957 6:38426559-38426581 TCCGGAAGAATGGAAGTCAGCGG - Intronic
1007166682 6:39833167-39833189 TCTGGAGGTGGGGAAGGAAGTGG + Intronic
1007316360 6:40992521-40992543 TCTGGACTGGTGGAAGTCCAGGG - Intergenic
1008582770 6:52921481-52921503 TCCAGAGGTATGGAAGTCAGTGG + Intergenic
1009023937 6:57975000-57975022 TCCAGATGGGTGGAAGTCAGTGG - Intergenic
1009199509 6:60726539-60726561 TCCGGATGGGAGGAAGTCACCGG - Intergenic
1009519545 6:64664038-64664060 TCTGGAGGGATGGAAGTAAGCGG + Intronic
1009702464 6:67201750-67201772 TCCAGAGGGGTGGAAGTCAGCGG - Intergenic
1009885210 6:69617061-69617083 TCCAGAGGGGTTGAAGTCAGCGG - Intergenic
1010893022 6:81337365-81337387 TCTGGAAGAATGGAAGTCAGCGG - Intergenic
1010895032 6:81351514-81351536 TCCGGAAGAATGGAAGTCAGCGG - Intergenic
1011076391 6:83443916-83443938 GCCGGAGGGGTGAAAGTCAGTGG - Intergenic
1011189083 6:84712031-84712053 TCCAGAGGGGTGGAAGTCAATGG + Intronic
1011190317 6:84720718-84720740 TCCAGAGGGGTGGAAGTCAACGG + Intronic
1012120020 6:95354766-95354788 TCCGGAGGGGTGGAAGTCAGTGG - Intergenic
1012692142 6:102327684-102327706 CCTGCAGGGCTGGAAGTCTGTGG + Intergenic
1013021761 6:106228291-106228313 TCCAGAGGGATGGAAGTCAGTGG - Intronic
1013050985 6:106534820-106534842 TGTGTAGGGGTGGAAGTGGGGGG + Intronic
1013410511 6:109879636-109879658 TCCAGAGGGGTGGAAGTCAGTGG - Intergenic
1013543078 6:111131174-111131196 TCCAGAGGGGTGGAAGTCAGCGG - Intronic
1014014694 6:116516966-116516988 TCTGGAGGCTGGGAAGTCCGAGG + Exonic
1014243344 6:119041694-119041716 TCCGGAGGGGTGGAAGTCAGCGG - Intronic
1015169388 6:130234685-130234707 TCTGTAGGGGAGGAAACCAGTGG - Intronic
1015632770 6:135247981-135248003 TCCAGAGGGGTGGAAGTCAGTGG - Intergenic
1016343646 6:143087531-143087553 TCCAGAGGGATGGAAGTCAGCGG + Intronic
1016444921 6:144121387-144121409 TCCGGAGGGGTGGAAGTCAGCGG + Intergenic
1017503344 6:155045700-155045722 TCTGCAGTGGTTGAAGACAGCGG + Intronic
1017869002 6:158470209-158470231 TTCGGAGGGATGGGAGTCAGCGG + Intronic
1018124303 6:160667230-160667252 TGTGGAGGGTTGGAAGCAAGAGG - Intergenic
1018760555 6:166891229-166891251 TCCGGAGGGATGGAAGTCAGCGG - Intronic
1019311494 7:363789-363811 TCTGCAGGGGAGCAGGTCAGGGG + Intergenic
1019688149 7:2393930-2393952 GCTGGAGGAGTTGAAGGCAGAGG - Intergenic
1020906211 7:14067247-14067269 TCTGGAGGGATGGAAGTCAGAGG - Intergenic
1021126222 7:16853383-16853405 TCTGGAGAGGTGAAAGTCAATGG - Intergenic
1021210735 7:17848661-17848683 TCGCGAGGGGTGGAATACAGTGG + Intronic
1021791555 7:24211050-24211072 AGTGGGGGGGTGGAGGTCAGGGG - Intergenic
1021885336 7:25131916-25131938 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1022015923 7:26348178-26348200 CCTCTAGGGGTGGAAGTGAGGGG - Intronic
1022029128 7:26476365-26476387 ACTGGTGGGGTGGAGGACAGGGG - Intergenic
1022117658 7:27276502-27276524 TCTGGAGGGATGGAAGTCAGTGG - Intergenic
1023094792 7:36649794-36649816 TCTGAAGAGATGGAAGTTAGCGG - Intronic
1023438998 7:40167785-40167807 TCTGGAGGGGTGGAAGTCAGCGG + Intronic
1023439769 7:40173331-40173353 TCCGGAGGGGTGGAAGTCAGCGG + Intronic
1023529181 7:41135854-41135876 TCTGGAGGAGGGGAAGGCATTGG + Intergenic
1024318647 7:48044195-48044217 TCCGGAGAGGTGGAAATTAGCGG + Intronic
1025716574 7:63962602-63962624 TCTGGAGGGATGGGAGTCAGTGG + Intergenic
1025950523 7:66141868-66141890 TCTGGGGTGGTGGAATTAAGGGG - Intronic
1026085639 7:67260797-67260819 TGTGGAGTGGTGAAAGACAGGGG + Intergenic
1026691526 7:72554086-72554108 TGTGGAGTGGTGAAAGACAGGGG - Intergenic
1026771291 7:73201582-73201604 TCTGGGGGGCTGGAAGACAAAGG - Intergenic
1027012158 7:74754979-74755001 TCTGGGGGGCTGGAAGACAAAGG - Intronic
1027075883 7:75191075-75191097 TCTGGGGGGCTGGAAGACAAAGG + Intergenic
1027308288 7:76925721-76925743 GCTGGAGGAATGGATGTCAGTGG + Intergenic
1027822581 7:83066155-83066177 TCTGTAGAGCTGGAAGTCATTGG - Intronic
1027868360 7:83675039-83675061 TCCGGAGGTATGGAAGTCAGCGG + Intergenic
1028147062 7:87330037-87330059 TCCAGAGGGGTGGAAGTCAGCGG + Intergenic
1028298669 7:89169143-89169165 TCCGGAGGAGTGAAAGTCAATGG + Intronic
1028587722 7:92468274-92468296 TCCAGAGGGATGGGAGTCAGCGG + Intergenic
1028589085 7:92477761-92477783 TCCAGAGGGATGGGAGTCAGCGG + Intronic
1028926147 7:96358686-96358708 TCCAGAGGGGTGGAAGTCAGCGG + Intergenic
1029015974 7:97315968-97315990 TCCAGAGGGATGGAAGTCAGTGG - Intergenic
1029191130 7:98773008-98773030 TCTAGAGGGATGGAACTCACAGG + Intergenic
1029444314 7:100604233-100604255 CCTGGAGGGGGGGAAGGCGGAGG - Intronic
1030208391 7:106972742-106972764 TCCGGAGGGGTGAAAGTCAGTGG + Intergenic
1030304246 7:108002971-108002993 TCTGGAGAGGTGGAAAGGAGGGG + Exonic
1030431259 7:109452214-109452236 TTCGGAGGGGTGGAAGTCAGAGG - Intergenic
1030661153 7:112221070-112221092 TCTGGAAGGGTGGAAGTCAGCGG - Intronic
1030717595 7:112828264-112828286 TCTGGAGGCTTAGAAGTCTGAGG + Intronic
1031299577 7:120047501-120047523 TCTGGAGGGATGGAAGGCAGTGG - Intergenic
1031472003 7:122177226-122177248 TCCGGAGGGGTGGAAGTCAGTGG - Intergenic
1032377565 7:131437220-131437242 TGTCGAGGGGTGGGGGTCAGGGG - Intronic
1032425788 7:131821167-131821189 TCCAGAGGGGTGGGAGTCAACGG + Intergenic
1032653847 7:133906721-133906743 TCTGGAGGGATGGAAGTCAGCGG - Intronic
1032725345 7:134585834-134585856 TCCAGAGAGGTGGAAGTCAATGG - Intergenic
1034248771 7:149671732-149671754 TCCAGAGGGGTGGAAGTCAGTGG - Intergenic
1034249500 7:149676852-149676874 TCCAGAAGGGTGGAAGTCAACGG - Intergenic
1034650840 7:152688830-152688852 TCCGGAGGGATGGAAGTCAGTGG + Intergenic
1034707074 7:153155173-153155195 TCCAGAGGGGTGGAAGTCAGTGG + Intergenic
1034965007 7:155385375-155385397 TCCGGAGGGATGGAAGTCGGCGG + Intronic
1035289037 7:157825398-157825420 TCTGGGGGGGAGGCAGTCTGAGG - Intronic
1035554730 8:558265-558287 TCTGGAGGGTGGGAAGTCCAAGG + Intergenic
1036192593 8:6684266-6684288 TGTGGAGAGGTGGGAGTCAGGGG + Intergenic
1036524924 8:9526215-9526237 TCATTAGTGGTGGAAGTCAGGGG + Intergenic
1037379954 8:18274625-18274647 TCCTGAGGGGTGGAAGTCAACGG + Intergenic
1037570607 8:20154871-20154893 TCTGGAGGGGTGGAAGTCAATGG - Intronic
1037648686 8:20817029-20817051 TCCGGAGGGATGGATGTCAGTGG + Intergenic
1037751096 8:21682963-21682985 GCTCCAAGGGTGGAAGTCAGGGG + Intergenic
1037972933 8:23187103-23187125 TCTGGAGGTTTGGAAGTCCAAGG - Intergenic
1038224693 8:25645028-25645050 CCTGGAGGGGTGGGAGGGAGGGG + Intergenic
1038742247 8:30225911-30225933 TCCAGAGGGATGGAAGTCAGCGG + Intergenic
1040509942 8:48084668-48084690 GCTGAAGGGGTGGGAGTCATAGG + Intergenic
1041741695 8:61163840-61163862 TCTGGAGGGGTGGAAGTCAATGG + Intronic
1041741910 8:61165207-61165229 TCCGGAAGAATGGAAGTCAGCGG + Intronic
1042055659 8:64763112-64763134 TCCGGAGGGGTGGAAGTCAGTGG - Intronic
1042281799 8:67064057-67064079 TGGGGAGGGGTGGTAGTGAGAGG - Intronic
1042292931 8:67188690-67188712 TCCGGAGGGGTGGAAGTCAGTGG - Intronic
1043042001 8:75275489-75275511 TCTGCTGGGCTGGAAGCCAGTGG + Intergenic
1044002056 8:86894896-86894918 TCTGGAGGCTGGGAAGTCAAAGG + Intronic
1044293647 8:90502428-90502450 TCTGGAGGCGGGGAAGTCCAAGG + Intergenic
1044988288 8:97774166-97774188 TCCAGAGGGGTGGAAGTCAACGG + Intergenic
1045664326 8:104468963-104468985 TTCAGAGGGGTGGAAGTCAGCGG - Intergenic
1045788635 8:105955523-105955545 TCTGGAGGGATAGGAGTCAGTGG + Intergenic
1045863512 8:106839359-106839381 TCCTGAGGGGTGGGAGTCAATGG + Intergenic
1047276656 8:123410798-123410820 TCTGGAGGGATAGAAGTCAGTGG - Intronic
1047599742 8:126413935-126413957 TCTGGAGGGGTGGAAGTCAGTGG + Intergenic
1048100254 8:131343195-131343217 TCCAGAAGGGTGGAAGTCAGTGG + Intergenic
1048183186 8:132214947-132214969 TGTGGATGGGCAGAAGTCAGAGG - Intronic
1048275573 8:133063230-133063252 TCTGGAGGGGTGGAACTTATGGG - Intronic
1048311880 8:133329046-133329068 GATGGAGGGGTGCAAGGCAGAGG - Intergenic
1048631496 8:136247682-136247704 TCCAGAGGGGTGGAAGTCAGCGG - Intergenic
1049316743 8:141973300-141973322 TCTGGAGGCCGGGAAGTCCGAGG + Intergenic
1050593504 9:7183578-7183600 TCCAGAGGGATGGAAGTCAGTGG - Intergenic
1051699189 9:19801385-19801407 TGCCGAGGGATGGAAGTCAGCGG + Intergenic
1051870079 9:21727298-21727320 TCTGAAGGGATGGAAGTCAGTGG - Intergenic
1051970172 9:22878040-22878062 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1052419422 9:28223315-28223337 TCTGGAGGGGAGGAATGCTGTGG + Intronic
1052852404 9:33386027-33386049 TCCTGAGGGGTGGAGGGCAGGGG + Intronic
1053215196 9:36265046-36265068 TCCGGAGGGGTGGAAGTCAGCGG - Intronic
1053470053 9:38339940-38339962 CCTGATGGGGTGGAAGTCACTGG + Intergenic
1053680503 9:40482578-40482600 TCCTGAGGGGTGGAGGGCAGGGG + Intergenic
1053930492 9:43110889-43110911 TCCTGAGGGGTGGAGGGCAGGGG + Intergenic
1054283209 9:63142357-63142379 TCCTGAGGGGTGGAGGGCAGGGG - Intergenic
1054293588 9:63318093-63318115 TCCTGAGGGGTGGAGGGCAGGGG + Intergenic
1054391610 9:64622582-64622604 TCCTGAGGGGTGGAGGGCAGGGG + Intergenic
1054504118 9:65893746-65893768 TCCTGAGGGGTGGAGGGCAGGGG - Intronic
1054860749 9:69950353-69950375 TCTGGAGGCTAGGAAGTCAAAGG - Intergenic
1055049592 9:71965001-71965023 TCCAGAGGGATGGAAGTCAGTGG + Intronic
1055130929 9:72773663-72773685 TCTGGTTGGGCTGAAGTCAGAGG + Intronic
1055431339 9:76247187-76247209 TCTGGAGGGATGGAAGTCAGCGG + Intronic
1055455700 9:76469642-76469664 TCCAGAGGGATGGAAGTCAGTGG - Intronic
1055789836 9:79911926-79911948 TCCGGAGGTGGGGAAGTCAGCGG + Intergenic
1056103501 9:83323636-83323658 TCTGGAGGCGTGGAAGTTTAAGG - Intronic
1056312382 9:85353370-85353392 CCTGGGGTGGTGGAAGACAGTGG + Intergenic
1056705009 9:88944246-88944268 TCCAGAGGGATGGAAGTCAGCGG + Intergenic
1057622044 9:96644944-96644966 GCTGGAGGGCTGGAGTTCAGTGG + Intronic
1057705507 9:97392361-97392383 TCTGGAGGGGTGGATGTGGAAGG + Intergenic
1058231951 9:102436790-102436812 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1059401923 9:114076124-114076146 GGTGGAAGGGTGGAGGTCAGAGG + Intronic
1060000482 9:119953805-119953827 TCAGGAGGGGTGGAAAGAAGTGG - Intergenic
1060093008 9:120761321-120761343 TGTGGTGTGGTGGAAGCCAGCGG - Exonic
1060234131 9:121850416-121850438 GCTGGAGGGGTGGGGGTGAGGGG + Intronic
1060391341 9:123279839-123279861 TCTGGAGGCTGGGAAGTCTGAGG - Intergenic
1061203790 9:129151669-129151691 TGTGGAGGGGTGGCTGGCAGGGG + Intergenic
1061244431 9:129394211-129394233 TCTGGAGGGAAGGAAGCCAGTGG + Intergenic
1061273461 9:129556991-129557013 TCTGGAGGGATGGAAGCCATCGG + Intergenic
1061319394 9:129818584-129818606 TCTGGAGGAGTGGAAAGCAGAGG - Exonic
1061591078 9:131598022-131598044 TCTGGAGGGGTAGACTCCAGGGG - Intronic
1061838538 9:133344551-133344573 CCTGCAGGAGTGGAAGCCAGAGG - Intronic
1061839804 9:133352022-133352044 GCTGAAGGGGAGGAAGCCAGAGG + Intronic
1062433089 9:136534760-136534782 ACTGCAGGTGTGGATGTCAGAGG + Intronic
1062480284 9:136747879-136747901 GCTGGAGGGTTGGAGGTCTGGGG - Intronic
1062532695 9:137008868-137008890 CCTGCAGGGGGGGAGGTCAGAGG + Exonic
1185560916 X:1060109-1060131 TCCGGAGGGGTGGAACTCAAAGG - Intergenic
1186540948 X:10399227-10399249 TCTGGAGCTGTGGAAGGGAGGGG - Intergenic
1188285588 X:28322522-28322544 GGAGGAGGGGTGGAAGTCAACGG - Intergenic
1189152093 X:38719476-38719498 TCTGGAGGGTTGGAAGTCAATGG + Intergenic
1189880419 X:45485898-45485920 TCTGGAGGCTTGGAAGTCCAAGG - Intergenic
1189954272 X:46261966-46261988 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1189955158 X:46270469-46270491 TCTGTAGGGGTGGGGCTCAGGGG - Intergenic
1189994920 X:46629115-46629137 TCTGGAAGGAAGGAGGTCAGGGG + Intronic
1190240564 X:48654937-48654959 TCTGGAGGGATGGAAGTCAATGG - Intergenic
1190368108 X:49716707-49716729 TCTGGAGGGGTGGAAGTCAGTGG - Intergenic
1190545553 X:51522792-51522814 TCTAGAGGGATGGAAGTAATAGG + Intergenic
1191071464 X:56405100-56405122 TTTGGGGGGGTGGAAGCTAGAGG - Intergenic
1191167482 X:57405525-57405547 TCCAGAGTGGTGGAAGTAAGTGG + Intronic
1191959399 X:66683717-66683739 TCTGGTGGGGTCAGAGTCAGTGG - Intergenic
1192576634 X:72247881-72247903 TCTGAAGGTGTGGAAGGAAGGGG + Intronic
1192940366 X:75904896-75904918 TCCAGAGGGATGGAAGTCAGTGG + Intergenic
1193295490 X:79827533-79827555 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1193306255 X:79956073-79956095 TCTGGAGGCATGGGAGTCAGTGG - Intergenic
1194010473 X:88554492-88554514 GCAGGTGGGGTGGGAGTCAGGGG + Intergenic
1194103276 X:89734552-89734574 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1194154501 X:90370265-90370287 TCCAGAGAGATGGAAGTCAGTGG + Intergenic
1194200901 X:90951891-90951913 TCTGTACGGATGGAAGTCGGTGG + Intergenic
1194445396 X:93981457-93981479 TCCGGAGTGATGGAAGTCAGCGG + Intergenic
1195158938 X:102152679-102152701 TCTGCAGTGGTAGAAGCCAGTGG + Intergenic
1195243673 X:102977846-102977868 TCCGGAGGGGTGAAAGTCAATGG - Intergenic
1195281590 X:103339814-103339836 TCTAGAGATGTGGAATTCAGGGG + Intergenic
1195282574 X:103350331-103350353 CCTGGAGGGGAGGAGGCCAGAGG - Intergenic
1195419552 X:104658460-104658482 TCTGGTGGGGTGGGAGGCAGGGG + Intronic
1195584608 X:106551426-106551448 TCCAGAGGGATGGAAGTCAGCGG - Intergenic
1196113239 X:111969684-111969706 GGGGTAGGGGTGGAAGTCAGGGG + Intronic
1196258166 X:113547168-113547190 TCCGGAGCGATGGAAGTCAACGG + Intergenic
1196772521 X:119309121-119309143 TCCGGAGGGATGGAAGTCAGTGG + Intergenic
1196993637 X:121356657-121356679 TCTGGAGGGGTGAAAGTCAGTGG - Intergenic
1197339071 X:125243764-125243786 TCTGTAGGTGTGGAAGTAGGTGG + Intergenic
1197514941 X:127415377-127415399 GATGGAGGGGTGGAAGTGATAGG - Intergenic
1197545323 X:127816569-127816591 TCCGGAGGGATGGAAGTCAGCGG + Intergenic
1197999713 X:132420312-132420334 TCTGGAGGGGTGGAAGTCAGCGG + Intronic
1198104036 X:133445759-133445781 CCTGGAGGGGCGGAAATGAGAGG - Intergenic
1198416547 X:136425854-136425876 GGTGGAGGGGTGGAGGTCACTGG + Intergenic
1198566836 X:137913876-137913898 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
1198741724 X:139849995-139850017 TCTGGAGGGTAGGAAGTCAAAGG - Intronic
1198765453 X:140075314-140075336 ACTGGTGGGGATGAAGTCAGAGG - Intergenic
1198771811 X:140138516-140138538 ACTGGTGGGGATGAAGTCAGAGG - Intergenic
1198862335 X:141084382-141084404 TCTGGAGGAGTGGAAGTCAATGG - Intergenic
1198900359 X:141503004-141503026 TCTGGAGGAGTGGAAGTCAATGG + Intergenic
1199268782 X:145858470-145858492 TCTGGAGGGATGGAAGTCAGCGG + Intergenic
1199368811 X:147020938-147020960 TCTGGAGGGATGGGAGTCAGCGG - Intergenic
1199497760 X:148472085-148472107 TATGGAGGCTTGGAAGTCAAAGG - Intergenic
1199536304 X:148906806-148906828 TCCGGAGGGGTGGAAGTCAAGGG - Intronic
1199614020 X:149640845-149640867 TCAGTATGGGTGGAAGGCAGTGG - Intergenic
1200061414 X:153485437-153485459 CCTGGAGGGAAGGAAGTGAGTGG + Intronic
1200133911 X:153865471-153865493 ACTGGAGGGAGGGCAGTCAGAGG - Exonic
1200308516 X:155053644-155053666 ACTGGAGGGTTAGAAGACAGTGG + Intronic
1200415978 Y:2910319-2910341 TCTGGAGGGGTGGAAGTCACGGG + Intronic
1200500854 Y:3947158-3947180 TCCAGAGAGATGGAAGTCAGTGG + Intergenic
1200546751 Y:4527349-4527371 TCTGGACGGATGGAAGTCAGCGG + Intergenic
1200762686 Y:7054619-7054641 TCTGGAGGGATGGAAGTCAGCGG - Intronic
1200851260 Y:7886373-7886395 TCCAGAGGGGTGGAAGTCAGTGG + Intergenic
1201070545 Y:10143962-10143984 TCTGGAGGTGAGGAAGTCCAAGG - Intergenic
1201233786 Y:11891152-11891174 TCTGGAATGGTGGAACCCAGTGG + Intergenic
1201329234 Y:12800038-12800060 TCTGGAGGGGTGGAAGTCAATGG - Intronic
1201421478 Y:13804579-13804601 TCTGGAGGGGTGGAAGTCAGTGG - Intergenic
1201642242 Y:16192166-16192188 TCTGGAGGGGTGGAAGTCAGTGG + Intergenic
1201660573 Y:16393155-16393177 TCTGGAGGGGTGGAAGTCAGTGG - Intergenic
1201905233 Y:19080351-19080373 TCCAGAGGGATGGAAGTCAGTGG - Intergenic
1201906116 Y:19087147-19087169 TCTGGAGGGGTGTAAGTCAGTGG - Intergenic
1201962279 Y:19694678-19694700 TCTGGAGGGGTGGGAGTCAACGG + Intergenic
1202062375 Y:20900858-20900880 TCTGGAGGGATGGAAGTCAGTGG - Intergenic