ID: 1166165663

View in Genome Browser
Species Human (GRCh38)
Location 19:40986601-40986623
Sequence GAAGTCAGTGGCACATCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165652_1166165663 27 Left 1166165652 19:40986551-40986573 CCTTGCTGGGTCAGGAGTGCAGC No data
Right 1166165663 19:40986601-40986623 GAAGTCAGTGGCACATCGGCAGG No data
1166165659_1166165663 -1 Left 1166165659 19:40986579-40986601 CCATGCTGGATCTGGAGGGGTGG 0: 16
1: 50
2: 105
3: 152
4: 348
Right 1166165663 19:40986601-40986623 GAAGTCAGTGGCACATCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165663 Original CRISPR GAAGTCAGTGGCACATCGGC AGG Intergenic
No off target data available for this crispr