ID: 1166165830

View in Genome Browser
Species Human (GRCh38)
Location 19:40987674-40987696
Sequence GAAGCCAAAGAGCCACAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165830_1166165832 -10 Left 1166165830 19:40987674-40987696 CCGCCTTGTGGCTCTTTGGCTTC No data
Right 1166165832 19:40987687-40987709 CTTTGGCTTCAATATCTGCTTGG No data
1166165830_1166165833 -7 Left 1166165830 19:40987674-40987696 CCGCCTTGTGGCTCTTTGGCTTC No data
Right 1166165833 19:40987690-40987712 TGGCTTCAATATCTGCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165830 Original CRISPR GAAGCCAAAGAGCCACAAGG CGG (reversed) Intergenic
No off target data available for this crispr