ID: 1166165832

View in Genome Browser
Species Human (GRCh38)
Location 19:40987687-40987709
Sequence CTTTGGCTTCAATATCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166165829_1166165832 -9 Left 1166165829 19:40987673-40987695 CCCGCCTTGTGGCTCTTTGGCTT No data
Right 1166165832 19:40987687-40987709 CTTTGGCTTCAATATCTGCTTGG No data
1166165830_1166165832 -10 Left 1166165830 19:40987674-40987696 CCGCCTTGTGGCTCTTTGGCTTC No data
Right 1166165832 19:40987687-40987709 CTTTGGCTTCAATATCTGCTTGG No data
1166165823_1166165832 19 Left 1166165823 19:40987645-40987667 CCTTCTATAAGCATTTCTAATGG 0: 75
1: 45
2: 10
3: 54
4: 200
Right 1166165832 19:40987687-40987709 CTTTGGCTTCAATATCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166165832 Original CRISPR CTTTGGCTTCAATATCTGCT TGG Intergenic
No off target data available for this crispr