ID: 1166166193

View in Genome Browser
Species Human (GRCh38)
Location 19:40990728-40990750
Sequence GCATTTACATTTGTGTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166166193_1166166195 29 Left 1166166193 19:40990728-40990750 CCACAACACACAAATGTAAATGC No data
Right 1166166195 19:40990780-40990802 AGGAAGCTCATACACATGCAAGG No data
1166166193_1166166194 9 Left 1166166193 19:40990728-40990750 CCACAACACACAAATGTAAATGC No data
Right 1166166194 19:40990760-40990782 TATAAAACTGTATAAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166166193 Original CRISPR GCATTTACATTTGTGTGTTG TGG (reversed) Intergenic
No off target data available for this crispr