ID: 1166173856

View in Genome Browser
Species Human (GRCh38)
Location 19:41051541-41051563
Sequence CTGTATGAACACAAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166173856_1166173862 19 Left 1166173856 19:41051541-41051563 CCCTGCTGCTTGTGTTCATACAG No data
Right 1166173862 19:41051583-41051605 TTTGGCATTTTAAAATGGTTGGG No data
1166173856_1166173863 20 Left 1166173856 19:41051541-41051563 CCCTGCTGCTTGTGTTCATACAG No data
Right 1166173863 19:41051584-41051606 TTGGCATTTTAAAATGGTTGGGG No data
1166173856_1166173861 18 Left 1166173856 19:41051541-41051563 CCCTGCTGCTTGTGTTCATACAG No data
Right 1166173861 19:41051582-41051604 TTTTGGCATTTTAAAATGGTTGG No data
1166173856_1166173859 1 Left 1166173856 19:41051541-41051563 CCCTGCTGCTTGTGTTCATACAG No data
Right 1166173859 19:41051565-41051587 CTGCAAACTATGAATGCTTTTGG No data
1166173856_1166173860 14 Left 1166173856 19:41051541-41051563 CCCTGCTGCTTGTGTTCATACAG No data
Right 1166173860 19:41051578-41051600 ATGCTTTTGGCATTTTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166173856 Original CRISPR CTGTATGAACACAAGCAGCA GGG (reversed) Intergenic
No off target data available for this crispr