ID: 1166173859

View in Genome Browser
Species Human (GRCh38)
Location 19:41051565-41051587
Sequence CTGCAAACTATGAATGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166173857_1166173859 0 Left 1166173857 19:41051542-41051564 CCTGCTGCTTGTGTTCATACAGC No data
Right 1166173859 19:41051565-41051587 CTGCAAACTATGAATGCTTTTGG No data
1166173856_1166173859 1 Left 1166173856 19:41051541-41051563 CCCTGCTGCTTGTGTTCATACAG No data
Right 1166173859 19:41051565-41051587 CTGCAAACTATGAATGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166173859 Original CRISPR CTGCAAACTATGAATGCTTT TGG Intergenic
No off target data available for this crispr